Regulon of PhnR in Vibrio shilonii AK1

Properties
Regulator type:	Transcription factor
TF locus tag:	VSAK1_17747
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Phosphonate utilization; 2-aminoethylphosphonate utilization
Effector:
Regulog:	PhnR - Vibrionales
Statistics of regulated genes:
- Genes	14
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 48 sites [see more]

Member of regulog collections

By trascription factor - PhnR
By taxonomy - Vibrionales
By TF family - GntR/Others
By pathway - Phosphonate utilization
By pathway - 2-aminoethylphosphonate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -214 Score: 5.5 Sequence: TATTTGGACTATACCAATTT Position: -35 Score: 5 Sequence: AAACTGGTACAGACCAAATC Locus tag: VSAK1_17762 Name: phnS Funciton: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)
	VSAK1_17762	phnS	2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)
Position: -53 Score: 4.7 Sequence: CCAATGAAATATACCAGATT Position: -31 Score: 5.9 Sequence: AATTTGGTATATACCATTTG Locus tag: VSAK1_17757 Name: phnT Funciton: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1) Locus tag: VSAK1_17752 Name: phnU Funciton: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9. Locus tag: VSAK1_17747 Name: phnR Funciton: 2-aminoethylphosphonate utilization regulator, GntR family
	VSAK1_17757	phnT	2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)
	VSAK1_17752	phnU	2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.
	VSAK1_17747	phnR	2-aminoethylphosphonate utilization regulator, GntR family
Position: -30 Score: 3.5 Sequence: TTACTGACCTAGTCCAGAGG Locus tag: VSAK1_19529 Name: phnS2 Funciton: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1) Locus tag: VSAK1_19524 Name: PF01663 Funciton: type I phosphodiesterase Locus tag: VSAK1_19519 Name: phnU2 Funciton: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1) Locus tag: VSAK1_19514 Name: phnV2 Funciton: 2-aminoethylphosphonate ABC transporter, permease protein II (TC 3.A.1.9.1) Locus tag: VSAK1_19509 Name: phnT2 Funciton: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1) Locus tag: VSAK1_19504 Name: COG0560 Funciton: Phosphoserine phosphatase (EC 3.1.3.3)
	VSAK1_19529	phnS2	2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)
	VSAK1_19524	PF01663	type I phosphodiesterase
	VSAK1_19519	phnU2	2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1)
	VSAK1_19514	phnV2	2-aminoethylphosphonate ABC transporter, permease protein II (TC 3.A.1.9.1)
	VSAK1_19509	phnT2	2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)
	VSAK1_19504	COG0560	Phosphoserine phosphatase (EC 3.1.3.3)
Position: -209 Score: 5 Sequence: GATTTGGTCTGTACCAGTTT Position: -30 Score: 5.5 Sequence: AAATTGGTATAGTCCAAATA Locus tag: VSAK1_17767 Name: phnW Funciton: 2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37) Locus tag: VSAK1_17772 Name: COG0160 Funciton: 4-aminobutyrate aminotransferase and related aminotransferases Locus tag: VSAK1_17777 Name: phnX Funciton: 2-phosphonoacetaldehyde hydrolase (EC 3.11.1.1)
	VSAK1_17767	phnW	2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37)
	VSAK1_17772	COG0160	4-aminobutyrate aminotransferase and related aminotransferases
	VSAK1_17777	phnX	2-phosphonoacetaldehyde hydrolase (EC 3.11.1.1)
Position: -123 Score: 3.5 Sequence: CCTCTGGACTAGGTCAGTAA Locus tag: VSAK1_19534 Name: phnR2 Funciton: 2-aminoethylphosphonate utilization regulator, GntR family
	VSAK1_19534	phnR2	2-aminoethylphosphonate utilization regulator, GntR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD