Regulon of PhnR in Vibrio fischeri ES114

Properties
Regulator type:	Transcription factor
TF locus tag:	VF_1530
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Phosphonate utilization; 2-aminoethylphosphonate utilization
Effector:
Regulog:	PhnR - Vibrionales
Statistics of regulated genes:
- Genes	6
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 48 sites [see more]

Member of regulog collections

By trascription factor - PhnR
By taxonomy - Vibrionales
By TF family - GntR/Others
By pathway - Phosphonate utilization
By pathway - 2-aminoethylphosphonate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -31 Score: 4.7 Sequence: TTATTGATGTAGTCCAAAAG Locus tag: VF_A1087 Name: phnS2 Funciton: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1) Locus tag: VF_A1088 Name: PF01663 Funciton: type I phosphodiesterase Locus tag: VF_A1089 Name: phnU2 Funciton: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1) Locus tag: VF_A1090 Name: phnV2 Funciton: 2-aminoethylphosphonate ABC transporter, permease protein II (TC 3.A.1.9.1) Locus tag: VF_A1091 Name: phnT2 Funciton: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1) Locus tag: VF_A1092 Name: COG0560 Funciton: Phosphoserine phosphatase (EC 3.1.3.3)
	VF_A1087	phnS2	2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)
	VF_A1088	PF01663	type I phosphodiesterase
	VF_A1089	phnU2	2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1)
	VF_A1090	phnV2	2-aminoethylphosphonate ABC transporter, permease protein II (TC 3.A.1.9.1)
	VF_A1091	phnT2	2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)
	VF_A1092	COG0560	Phosphoserine phosphatase (EC 3.1.3.3)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD