Regulon of PhnR in Vibrio angustum S14

Properties
Regulator type:	Transcription factor
TF locus tag:	VAS14_10969
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Phosphonate utilization; 2-aminoethylphosphonate utilization
Effector:
Regulog:	PhnR - Vibrionales
Statistics of regulated genes:
- Genes	8
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 48 sites [see more]

Member of regulog collections

By trascription factor - PhnR
By taxonomy - Vibrionales
By TF family - GntR/Others
By pathway - Phosphonate utilization
By pathway - 2-aminoethylphosphonate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -35 Score: 5 Sequence: TTAGTGGTCTATACCAATTA Locus tag: VAS14_11029 Name: null Funciton: Glycine/D-amino acid oxidase
	VAS14_11029		Glycine/D-amino acid oxidase
Position: -35 Score: 6 Sequence: AATTTGGTATATACCAATTA Locus tag: VAS14_10979 Name: phnT Funciton: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1) Locus tag: VAS14_10974 Name: phnU Funciton: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9. Locus tag: VAS14_10969 Name: phnR Funciton: 2-aminoethylphosphonate utilization regulator, GntR family
	VAS14_10979	phnT	2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)
	VAS14_10974	phnU	2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.
	VAS14_10969	phnR	2-aminoethylphosphonate utilization regulator, GntR family
Position: -231 Score: 5.7 Sequence: ATTTTGGTATGTACCAGTTT Position: -30 Score: 5.4 Sequence: AAACTGGTATAGTCCAAATG Locus tag: VAS14_11014 Name: phnW Funciton: 2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37) Locus tag: VAS14_11019 Name: COG0160 Funciton: 4-aminobutyrate aminotransferase and related aminotransferases Locus tag: VAS14_11024 Name: phnX Funciton: 2-phosphonoacetaldehyde hydrolase (EC 3.11.1.1)
	VAS14_11014	phnW	2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37)
	VAS14_11019	COG0160	4-aminobutyrate aminotransferase and related aminotransferases
	VAS14_11024	phnX	2-phosphonoacetaldehyde hydrolase (EC 3.11.1.1)
Position: -62 Score: 5.7 Sequence: AAACTGGTACATACCAAAAT Locus tag: VAS14_11009 Name: phnS Funciton: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)
	VAS14_11009	phnS	2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD