Regulon of PhnR in Vibrio cholerae O1 biovar eltor str. N16961

Properties
Regulator type:	Transcription factor
TF locus tag:	VCA0600
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Phosphonate utilization; 2-aminoethylphosphonate utilization
Effector:
Regulog:	PhnR - Vibrionales
Statistics of regulated genes:
- Genes	8
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 48 sites [see more]

Member of regulog collections

By trascription factor - PhnR
By taxonomy - Vibrionales
By TF family - GntR/Others
By pathway - Phosphonate utilization
By pathway - 2-aminoethylphosphonate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -224 Score: 5.7 Sequence: AATTTGGTATGTACCAGAAT Position: -28 Score: 5.2 Sequence: TTATTGGTATAGTCCAAAAA Locus tag: VCA0604 Name: phnW Funciton: 2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37) Locus tag: VCA0605 Name: COG0160 Funciton: 4-aminobutyrate aminotransferase and related aminotransferases Locus tag: VCA0606 Name: phnX Funciton: 2-phosphonoacetaldehyde hydrolase (EC 3.11.1.1)
	VCA0604	phnW	2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37)
	VCA0605	COG0160	4-aminobutyrate aminotransferase and related aminotransferases
	VCA0606	phnX	2-phosphonoacetaldehyde hydrolase (EC 3.11.1.1)
Position: 6 Score: 5.7 Sequence: ATTTTGGACTATACCAAATT Locus tag: VCA0602 Name: phnT Funciton: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1) Locus tag: VCA0601 Name: phnU Funciton: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9. Locus tag: VCA0600 Name: phnR Funciton: 2-aminoethylphosphonate utilization regulator, GntR family Locus tag: VCA0599 Name: VCA0599 Funciton: Permease of the drug/metabolite transporter (DMT) superfamily
	VCA0602	phnT	2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)
	VCA0601	phnU	2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.
	VCA0600	phnR	2-aminoethylphosphonate utilization regulator, GntR family
	VCA0599	VCA0599	Permease of the drug/metabolite transporter (DMT) superfamily
Position: -223 Score: 5.2 Sequence: TTTTTGGACTATACCAATAA Position: -27 Score: 5.7 Sequence: ATTCTGGTACATACCAAATT Locus tag: VCA0603 Name: phnS Funciton: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)
	VCA0603	phnS	2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD