Regulog RutR - Rhizobiales
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Pyrimidine utilization |
| Effector: | Uracil |
| Phylum: | Proteobacteria/alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By trascription factor - RutR
- By taxonomy - Rhizobiales
- By TF family - TetR
- By effector - Uracil
- By pathway - Pyrimidine utilization
| Genome | Genes | Operons |
|---|---|---|
| Sinorhizobium meliloti 1021 | 18 | 6 |
| Rhizobium sp. NGR234 | 16 | 6 |
| Rhizobium leguminosarum bv. viciae 3841 | 20 | 5 |
| Rhizobium etli CFN 42 | 20 | 5 |
| Agrobacterium tumefaciens str. C58 (Cereon) | 23 | 5 |
| Mesorhizobium sp. BNC1 | 16 | 4 |
| Mesorhizobium loti MAFF303099 | 18 | 6 |
| Brucella melitensis 16M | 6 | 3 |
| Bartonella quintana str. Toulouse | ||
| Rhodopseudomonas palustris CGA009 | ||
| Bradyrhizobium japonicum USDA 110 | ||
| Bradyrhizobium sp. BTAi1 | 9 | 3 |
| Nitrobacter winogradskyi Nb-255 | ||
| Azorhizobium caulinodans ORS 571 | ||
| Xanthobacter autotrophicus Py2 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| pydC |
*
Sinorhizobium meliloti 1021 Site: position = -145 score = 5.51835 sequence = TGTTTACCAACCGGTCAAAT Gene: SMc01820: Beta-ureidopropionase (EC 3.5.1.6) |
*
Rhizobium sp. NGR234 Site: position = -147 score = 5.51835 sequence = TGTTTACCAACCGGTCAAAT Gene: NGR_c24830: Beta-ureidopropionase (EC 3.5.1.6) |
*
Rhizobium leguminosarum bv. viciae 3841 Site: position = -159 score = 5.58419 sequence = TGTTTACCAATCGGTCAAAT Gene: RL3716: Beta-ureidopropionase (EC 3.5.1.6) |
*
Rhizobium etli CFN 42 Site: position = -156 score = 5.58419 sequence = TGTTTACCAATCGGTCAAAT Gene: RHE_CH03290: Beta-ureidopropionase (EC 3.5.1.6) |
*
Agrobacterium tumefaciens str. C58 (Cereon) Site: position = -145 score = 5.19787 sequence = TGTTTACCAGCCGGTCAATT Gene: Atu2385: Beta-ureidopropionase (EC 3.5.1.6) |
Gene: Meso_2043: Beta-ureidopropionase (EC 3.5.1.6) |
Gene: mll1631: Beta-ureidopropionase (EC 3.5.1.6) |
*
Brucella melitensis 16M Site: position = -148 score = 5.09773 sequence = TTTTGACCAACTAGTCAAGT Gene: BMEI1643: Beta-ureidopropionase (EC 3.5.1.6) |
|
|
|
Gene: BBta_6028: Beta-ureidopropionase (EC 3.5.1.6) |
|
|
|
Beta-ureidopropionase (EC 3.5.1.6) |
| pydB |
Gene: SMc01821: Dihydropyrimidinase (EC 3.5.2.2) |
Gene: NGR_c24840: Dihydropyrimidinase (EC 3.5.2.2) |
Gene: RL3718: Dihydropyrimidinase (EC 3.5.2.2) |
Gene: RHE_CH03292: Dihydropyrimidinase (EC 3.5.2.2) |
Gene: Atu2386: Dihydropyrimidinase (EC 3.5.2.2) |
Gene: Meso_2664: Dihydropyrimidinase (EC 3.5.2.2) |
Gene: mll1629: Dihydropyrimidinase (EC 3.5.2.2) |
Gene: BMEI1644: Dihydropyrimidinase (EC 3.5.2.2) |
|
|
Gene: blr7615: Dihydropyrimidinase (EC 3.5.2.2) |
Gene: BBta_6029: Dihydropyrimidinase (EC 3.5.2.2) |
|
|
|
Dihydropyrimidinase (EC 3.5.2.2) |
| Atu2387 |
|
|
|
|
Gene: Atu2387: NTP pyrophosphohydrolase, MutT family |
|
|
|
|
|
|
|
|
|
|
NTP pyrophosphohydrolase, MutT family |
| pytA |
Gene: SMc01823: Pyrimidine ABC transporter ATP-binding protein |
Gene: NGR_c24860: Pyrimidine ABC transporter ATP-binding protein |
Gene: RL3720: Pyrimidine ABC transporter ATP-binding protein |
Gene: RHE_CH03294: Pyrimidine ABC transporter ATP-binding protein |
Gene: Atu2388: Pyrimidine ABC transporter ATP-binding protein |
Gene: Meso_2044: Pyrimidine ABC transporter ATP-binding protein |
Gene: mll1625: Pyrimidine ABC transporter ATP-binding protein |
|
|
|
|
*
Bradyrhizobium sp. BTAi1 Site: position = -136 score = 5.05638 sequence = ATCTGATCAAATGGTCAAAT Gene: BBta_6033: Pyrimidine ABC transporter ATP-binding protein |
|
|
|
Pyrimidine ABC transporter ATP-binding protein |
| pytB |
Gene: SMc01825: Pyrimidine ABC transporter, permease protein 1 |
Gene: NGR_c24870: Pyrimidine ABC transporter, permease protein 1 |
Gene: RL3721: Pyrimidine ABC transporter, permease protein 1 |
Gene: RHE_CH03295: Pyrimidine ABC transporter, permease protein 1 |
Gene: Atu2389: Pyrimidine ABC transporter, permease protein 1 |
Gene: Meso_2045: Pyrimidine ABC transporter, permease protein 1 |
Gene: mll1624: Pyrimidine ABC transporter, permease protein 1 |
|
|
|
|
Gene: BBta_6032: Pyrimidine ABC transporter, permease protein 1 |
|
|
|
Pyrimidine ABC transporter, permease protein 1 |
| pytC |
Gene: SMc01826: Pyrimidine ABC transporter, permease protein 2 |
Gene: NGR_c24880: Pyrimidine ABC transporter, permease protein 2 |
Gene: RL3722: Pyrimidine ABC transporter, permease protein 2 |
Gene: RHE_CH03296: Pyrimidine ABC transporter, permease protein 2 |
Gene: Atu2390: Pyrimidine ABC transporter, permease protein 2 |
Gene: Meso_2046: Pyrimidine ABC transporter, permease protein 2 |
Gene: mll1623: Pyrimidine ABC transporter, permease protein 2 |
|
|
|
2
Bradyrhizobium japonicum USDA 110 Gene: bll3315: Pyrimidine ABC transporter, permease protein 2 Gene: bll3314: Pyrimidine ABC transporter, permease protein 2 |
Gene: BBta_6031: Pyrimidine ABC transporter, permease protein 2 |
|
2
Azorhizobium caulinodans ORS 571 Gene: AZC_2449: Pyrimidine ABC transporter, permease protein 2 Gene: AZC_2448: Pyrimidine ABC transporter, permease protein 2 |
|
Pyrimidine ABC transporter, permease protein 2 |
| pytD |
Gene: SMc01827: Pyrimidine ABC transporter, substrate-binding protein |
Gene: NGR_c24890: Pyrimidine ABC transporter, substrate-binding protein |
Gene: RL3723: Pyrimidine ABC transporter, substrate-binding protein |
Gene: RHE_CH03297: Pyrimidine ABC transporter, substrate-binding protein |
Gene: Atu2391: Pyrimidine ABC transporter, substrate-binding protein |
Gene: Meso_2047: Pyrimidine ABC transporter, substrate-binding protein |
Gene: mll1621: Pyrimidine ABC transporter, substrate-binding protein |
|
|
|
Gene: bll3316: Pyrimidine ABC transporter, substrate-binding protein |
Gene: BBta_6030: Pyrimidine ABC transporter, substrate-binding protein |
|
Gene: AZC_2447: Pyrimidine ABC transporter, substrate-binding protein |
|
Pyrimidine ABC transporter, substrate-binding protein |
| praX |
|
|
|
|
|
*
Mesorhizobium sp. BNC1 Site: position = -88 score = 4.94419 sequence = GATTGTCCAAACGGTCAAAA Gene: Meso_2042: Omega-amino acid--pyruvate aminotransferase (EC 2.6.1.18) |
*
Mesorhizobium loti MAFF303099 Site: position = -96 score = 5.33527 sequence = GTTTGTCCAATCGGTCAAAA Gene: mll1632: Omega-amino acid--pyruvate aminotransferase (EC 2.6.1.18) |
|
|
|
|
|
|
|
|
Omega-amino acid--pyruvate aminotransferase (EC 2.6.1.18) |
| RL3717 |
|
|
Gene: RL3717: Hypothetical protein |
Gene: RHE_CH03291: Hypothetical protein |
|
|
|
|
|
|
|
|
|
|
|
Hypothetical protein |
| CRON 2. | ||||||||||||||||
| pytM |
*
Sinorhizobium meliloti 1021 Site: position = -34 score = 5.47743 sequence = ATTCTACCAATCGGTAAAAA Gene: SMa2361: Predicted pyrimidine ABC transporter, substrate-binding protein |
*
Rhizobium sp. NGR234 Site: position = -62 score = 5.34277 sequence = CATTGACCAAGTGGTAAAAA Gene: NGR_b02360: Predicted pyrimidine ABC transporter, substrate-binding protein |
*
Rhizobium leguminosarum bv. viciae 3841 Site: position = -33 score = 5.3326 sequence = TTTGAACCAAATGGTAAAAA Gene: pRL90203: Predicted pyrimidine ABC transporter, substrate-binding protein |
*
Rhizobium etli CFN 42 Site: position = -32 score = 5.18993 sequence = TTTGAACCAGATGGTAAAAA Gene: RHE_PB00102: Predicted pyrimidine ABC transporter, substrate-binding protein |
|
|
*
Mesorhizobium loti MAFF303099 Site: position = -99 score = 5.5084 sequence = ATTTGACCATGTGGACAAAA Gene: mll4178: Predicted pyrimidine ABC transporter, substrate-binding protein |
|
|
|
|
|
|
|
|
Predicted pyrimidine ABC transporter, substrate-binding protein |
| pytH |
Gene: SMa2363: Predicted hydrolase |
|
Gene: pRL90204: Predicted hydrolase |
Gene: RHE_PB00103: Predicted hydrolase |
|
|
|
|
|
|
|
|
|
|
|
Predicted hydrolase |
| pytN |
Gene: SMa2365: Predicted pyrimidine ABC transporter, ATP-binding protein |
Gene: NGR_b02350: Predicted pyrimidine ABC transporter, ATP-binding protein |
Gene: pRL90205: Predicted pyrimidine ABC transporter, ATP-binding protein |
Gene: RHE_PB00104: Predicted pyrimidine ABC transporter, ATP-binding protein |
|
|
Gene: mll4176: Predicted pyrimidine ABC transporter, ATP-binding protein |
|
|
|
|
|
|
Gene: AZC_3200: Predicted pyrimidine ABC transporter, ATP-binding protein |
|
Predicted pyrimidine ABC transporter, ATP-binding protein |
| pytO |
Gene: SMa2367: Predicted pyrimidine ABC transporter, permease protein 1 |
Gene: NGR_b02340: Predicted pyrimidine ABC transporter, permease protein 1 |
Gene: pRL90206: Predicted pyrimidine ABC transporter, permease protein 1 |
Gene: RHE_PB00105: Predicted pyrimidine ABC transporter, permease protein 1 |
|
|
Gene: mll4175: Predicted pyrimidine ABC transporter, permease protein 1 |
|
|
|
|
|
|
|
|
Predicted pyrimidine ABC transporter, permease protein 1 |
| pytQ |
Gene: SMa2369: Predicted pyrimidine ABC transporter, permease protein 2 |
Gene: NGR_b02330: Predicted pyrimidine ABC transporter, permease protein 2 |
Gene: pRL90207: Predicted pyrimidine ABC transporter, permease protein 2 |
Gene: RHE_PB00106: Predicted pyrimidine ABC transporter, permease protein 2 |
|
|
Gene: mll4174: Predicted pyrimidine ABC transporter, permease protein 2 |
|
|
|
|
|
|
|
|
Predicted pyrimidine ABC transporter, permease protein 2 |
| codA |
Gene: SMa2371: Cytosine deaminase (EC 3.5.4.1) |
Gene: NGR_b17150: Cytosine deaminase (EC 3.5.4.1) |
Gene: pRL90208: Cytosine deaminase (EC 3.5.4.1) |
Gene: RHE_PB00107: Cytosine deaminase (EC 3.5.4.1) |
|
|
Gene: mlr5363: Cytosine deaminase (EC 3.5.4.1) |
|
|
|
Gene: bll7276: Cytosine deaminase (EC 3.5.4.1) |
|
|
|
|
Cytosine deaminase (EC 3.5.4.1) |
| CRON 3. | ||||||||||||||||
| rutA |
|
|
|
|
*
Agrobacterium tumefaciens str. C58 (Cereon) Site: position = -101 score = 5.21616 sequence = TTTTATCCATTTGATAAAAT Site: position = -157 score = 5.91029 sequence = TTTTTACCAAATGATAAAAA Gene: Atu2500: Pyrimidine oxygenase |
|
|
|
|
|
|
Gene: BBta_1128: Pyrimidine oxygenase |
|
|
|
Pyrimidine oxygenase |
| rutB |
|
|
|
|
Gene: Atu2499: Peroxyureidoacrylate / ureidoacrylate amido hydrolase |
|
|
|
|
|
|
|
|
Gene: AZC_2493: Peroxyureidoacrylate / ureidoacrylate amido hydrolase |
|
Peroxyureidoacrylate / ureidoacrylate amido hydrolase |
| rutC |
|
|
|
|
Gene: Atu2498: Aminoacrylate peracid reductase |
|
|
|
|
Gene: RPA3591: Aminoacrylate peracid reductase |
Gene: blr6667: Aminoacrylate peracid reductase |
Gene: BBta_6227: Aminoacrylate peracid reductase |
|
Gene: AZC_2494: Aminoacrylate peracid reductase |
|
Aminoacrylate peracid reductase |
| rutD |
|
|
|
|
Gene: Atu2497: Aminoacrylate hydrolase |
|
|
|
|
|
|
|
|
Gene: AZC_2496: Aminoacrylate hydrolase |
|
Aminoacrylate hydrolase |
| rutE |
|
|
|
|
Gene: Atu2496: 3-hydroxy propionic acid dehydrogenase |
|
|
|
|
Gene: RPA4285: 3-hydroxy propionic acid dehydrogenase |
|
|
|
|
|
3-hydroxy propionic acid dehydrogenase |
| rutF |
|
|
|
|
Gene: Atu2495: Flavin reductase |
|
|
|
|
|
|
|
|
|
|
Flavin reductase |
| CRON 4. | ||||||||||||||||
| hpt |
Gene: SMc00719: Hypoxanthine-guanine phosphoribosyltransferase (EC 2.4.2.8) |
Gene: NGR_c26990: Hypoxanthine-guanine phosphoribosyltransferase (EC 2.4.2.8) |
Gene: RL4328: Hypoxanthine-guanine phosphoribosyltransferase (EC 2.4.2.8) |
Gene: RHE_CH03800: Hypoxanthine-guanine phosphoribosyltransferase (EC 2.4.2.8) |
*
Agrobacterium tumefaciens str. C58 (Cereon) Site: position = -46 score = 5.0907 sequence = TTTTTACTGAAAGGTAAAAT Gene: Atu3604: Hypoxanthine-guanine phosphoribosyltransferase (EC 2.4.2.8) |
Gene: Meso_3093: Hypoxanthine-guanine phosphoribosyltransferase (EC 2.4.2.8) |
Gene: mll3520: Hypoxanthine-guanine phosphoribosyltransferase (EC 2.4.2.8) |
Gene: BMEI0082: Hypoxanthine-guanine phosphoribosyltransferase (EC 2.4.2.8) |
|
|
|
|
|
Gene: AZC_4610: Hypoxanthine-guanine phosphoribosyltransferase (EC 2.4.2.8) |
Gene: Xaut_0023: Hypoxanthine-guanine phosphoribosyltransferase (EC 2.4.2.8) |
Hypoxanthine-guanine phosphoribosyltransferase (EC 2.4.2.8) |
| CRON 5. | ||||||||||||||||
| rutR |
*
Sinorhizobium meliloti 1021 Site: position = -153 score = 5.73512 sequence = ATTTGACCGGTTGGTAAACA Gene: SMc01819: Transcriptional regulator RutR of pyrimidine catabolism, TetR family |
*
Rhizobium sp. NGR234 Site: position = -153 score = 5.73512 sequence = ATTTGACCGGTTGGTAAACA Gene: NGR_c24820: Transcriptional regulator RutR of pyrimidine catabolism, TetR family |
*
Rhizobium leguminosarum bv. viciae 3841 Site: position = -162 score = 5.87779 sequence = ATTTGACCGATTGGTAAACA Gene: RL3715: Transcriptional regulator RutR of pyrimidine catabolism, TetR family |
*
Rhizobium etli CFN 42 Site: position = -163 score = 5.87779 sequence = ATTTGACCGATTGGTAAACA Gene: RHE_CH03289: Transcriptional regulator RutR of pyrimidine catabolism, TetR family |
*
Agrobacterium tumefaciens str. C58 (Cereon) Site: position = -153 score = 5.40023 sequence = AATTGACCGGCTGGTAAACA Gene: Atu2384: Transcriptional regulator RutR of pyrimidine catabolism, TetR family |
*
Mesorhizobium sp. BNC1 Site: position = -130 score = 5.1891 sequence = TTTTGACCGTTTGGACAATC Gene: Meso_2041: Transcriptional regulator RutR of pyrimidine catabolism, TetR family |
*
Mesorhizobium loti MAFF303099 Site: position = -151 score = 5.48877 sequence = TTTTGACCGATTGGACAAAC Gene: mlr1634: Transcriptional regulator RutR of pyrimidine catabolism, TetR family |
*2
Brucella melitensis 16M Site: position = -90 score = 5.31183 sequence = ACTTGACTAGTTGGTCAAAA Gene: BMEI1642: Transcriptional regulator RutR of pyrimidine catabolism, TetR family Gene: BMEI1641: Transcriptional regulator RutR of pyrimidine catabolism, TetR family |
|
|
|
*
Bradyrhizobium sp. BTAi1 Site: position = -81 score = 5.35908 sequence = ATTTGACCATTTGATCAGAT Gene: BBta_6034: Transcriptional regulator RutR of pyrimidine catabolism, TetR family |
|
|
|
Transcriptional regulator RutR of pyrimidine catabolism, TetR family |
| CRON 6. | ||||||||||||||||
| pydX |
*
Sinorhizobium meliloti 1021 Site: position = -71 score = 5.82174 sequence = ATTTTACCGTTTGATAAAAA Gene: SMc01814: Pyridine nucleotide-disulphide oxidoreductase associated with reductive pyrimidine catabolism |
*
Rhizobium sp. NGR234 Site: position = -70 score = 5.82174 sequence = ATTTTACCGTTTGATAAAAA Gene: NGR_c24760: Pyridine nucleotide-disulphide oxidoreductase associated with reductive pyrimidine catabolism |
*
Rhizobium leguminosarum bv. viciae 3841 Site: position = -78 score = 5.60247 sequence = ATTTTACCGTTTGATAAATT Gene: RL3707: Pyridine nucleotide-disulphide oxidoreductase associated with reductive pyrimidine catabolism |
*
Rhizobium etli CFN 42 Site: position = -77 score = 5.60247 sequence = ATTTTACCGTTTGATAAATT Gene: RHE_CH03277: Pyridine nucleotide-disulphide oxidoreductase associated with reductive pyrimidine catabolism |
|
*
Mesorhizobium sp. BNC1 Site: position = -64 score = 5.56095 sequence = ATTTGACTGATTGATAAAAA Gene: Meso_2057: Pyridine nucleotide-disulphide oxidoreductase associated with reductive pyrimidine catabolism |
*
Mesorhizobium loti MAFF303099 Site: position = -68 score = 5.81602 sequence = AATTGACCAATTGATAAAAA Gene: mll1646: Pyridine nucleotide-disulphide oxidoreductase associated with reductive pyrimidine catabolism |
*
Brucella melitensis 16M Site: position = -158 score = 5.4513 sequence = AATTGACCGGATGATAAAAA Gene: BMEI1638: Pyridine nucleotide-disulphide oxidoreductase associated with reductive pyrimidine catabolism |
|
|
|
*
Bradyrhizobium sp. BTAi1 Site: position = -82 score = 5.60495 sequence = TTTTGATCAACTGGTCAAAT Gene: BBta_6036: Pyridine nucleotide-disulphide oxidoreductase associated with reductive pyrimidine catabolism |
|
|
|
Pyridine nucleotide-disulphide oxidoreductase associated with reductive pyrimidine catabolism |
| mll1644 |
|
|
|
|
|
|
Gene: mll1644: Predicted methyltransferase |
|
|
|
|
|
|
|
|
Predicted methyltransferase |
| pydA |
Gene: SMc01815: Dihydropyrimidine dehydrogenase [NADP+] (EC 1.3.1.2) |
Gene: NGR_c24770: Dihydropyrimidine dehydrogenase [NADP+] (EC 1.3.1.2) |
Gene: RL3708: Dihydropyrimidine dehydrogenase [NADP+] (EC 1.3.1.2) |
Gene: RHE_CH03278: Dihydropyrimidine dehydrogenase [NADP+] (EC 1.3.1.2) |
|
Gene: Meso_2055: Dihydropyrimidine dehydrogenase [NADP+] (EC 1.3.1.2) |
Gene: mll1643: Dihydropyrimidine dehydrogenase [NADP+] (EC 1.3.1.2) |
Gene: BMEI1639: Dihydropyrimidine dehydrogenase [NADP+] (EC 1.3.1.2) |
|
|
|
Gene: BBta_6035: Dihydropyrimidine dehydrogenase [NADP+] (EC 1.3.1.2) |
|
|
|
Dihydropyrimidine dehydrogenase [NADP+] (EC 1.3.1.2) |
| Meso_2056 |
|
|
|
|
|
Gene: Meso_2056: Hypothetical protein |
|
|
|
|
|
|
|
|
|
Hypothetical protein |
| CRON 7. | ||||||||||||||||
| pntD |
*
Sinorhizobium meliloti 1021 Site: position = -157 score = 5.38298 sequence = TTTTTACCATCCGAAAAAAT Gene: SMc02884: Predicted nucleoside ABC transporter, substrate-binding protein |
*
Rhizobium sp. NGR234 Site: position = -159 score = 5.20517 sequence = TTTTTACCATCCGAAAAATT Gene: NGR_c35400: Predicted nucleoside ABC transporter, substrate-binding protein |
*
Rhizobium leguminosarum bv. viciae 3841 Site: position = -155 score = 5.11548 sequence = TCTTTACCAGCTGAAAAATT Gene: RL0196: Predicted nucleoside ABC transporter, substrate-binding protein |
*
Rhizobium etli CFN 42 Site: position = -154 score = 4.84007 sequence = TCTTTACCGCCTGAAAAATT Gene: RHE_CH00187: Predicted nucleoside ABC transporter, substrate-binding protein |
*
Agrobacterium tumefaciens str. C58 (Cereon) Site: position = -164 score = 4.66015 sequence = GTTTTTCCACCGGGTCAAAA Gene: Atu0126: Predicted nucleoside ABC transporter, substrate-binding protein |
Gene: Meso_3982: Predicted nucleoside ABC transporter, substrate-binding protein |
*
Mesorhizobium loti MAFF303099 Site: position = -165 score = 4.72736 sequence = GCTTTTCCAAAAGGTCAAAA Gene: mlr3148: Predicted nucleoside ABC transporter, substrate-binding protein |
|
|
|
|
|
|
|
|
Predicted nucleoside ABC transporter, substrate-binding protein |
| pntA |
*
Sinorhizobium meliloti 1021 Site: position = -80 score = 5.2582 sequence = CTTATACCAAATGGTAAAAA Gene: SMc04127: Predicted nucleoside ABC transporter, ATP-binding protein |
*
Rhizobium sp. NGR234 Site: position = -78 score = 5.2582 sequence = CTTATACCAAATGGTAAAAA Gene: NGR_c34500: Predicted nucleoside ABC transporter, ATP-binding protein |
Gene: RL0197: Predicted nucleoside ABC transporter, ATP-binding protein |
Gene: RHE_CH00188: Predicted nucleoside ABC transporter, ATP-binding protein |
Gene: Atu0127: Predicted nucleoside ABC transporter, ATP-binding protein |
*
Mesorhizobium sp. BNC1 Site: position = -18 score = 5.26567 sequence = TGTTGACCAAAAGATAAAAT Gene: Meso_3652: Predicted nucleoside ABC transporter, ATP-binding protein |
*
Mesorhizobium loti MAFF303099 Site: position = -41 score = 5.57618 sequence = TTTTGACCAAGCGATAAAAA Gene: mlr3154: Predicted nucleoside ABC transporter, ATP-binding protein |
|
|
|
|
|
|
|
|
Predicted nucleoside ABC transporter, ATP-binding protein |
| pntB |
Gene: SMc04126: Predicted nucleoside ABC transporter, permease protein 1 |
Gene: NGR_c34510: Predicted nucleoside ABC transporter, permease protein 1 |
Gene: RL0198: Predicted nucleoside ABC transporter, permease protein 1 |
Gene: RHE_CH00189: Predicted nucleoside ABC transporter, permease protein 1 |
Gene: Atu0128: Predicted nucleoside ABC transporter, permease protein 1 |
Gene: Meso_3653: Predicted nucleoside ABC transporter, permease protein 1 |
Gene: mlr3155: Predicted nucleoside ABC transporter, permease protein 1 |
|
|
|
|
|
|
|
|
Predicted nucleoside ABC transporter, permease protein 1 |
| pntC |
Gene: SMc04125: Predicted nucleoside ABC transporter, permease protein 2 |
Gene: NGR_c34520: Predicted nucleoside ABC transporter, permease protein 2 |
Gene: RL0199: Predicted nucleoside ABC transporter, permease protein 2 |
Gene: RHE_CH00190: Predicted nucleoside ABC transporter, permease protein 2 |
Gene: Atu0129: Predicted nucleoside ABC transporter, permease protein 2 |
Gene: Meso_3654: Predicted nucleoside ABC transporter, permease protein 2 |
Gene: mlr3157: Predicted nucleoside ABC transporter, permease protein 2 |
|
|
|
|
|
|
|
|
Predicted nucleoside ABC transporter, permease protein 2 |
| cdd |
Gene: SMc04124: Cytidine deaminase (EC 3.5.4.5) |
Gene: NGR_c34530: Cytidine deaminase (EC 3.5.4.5) |
Gene: RL0200: Cytidine deaminase (EC 3.5.4.5) |
Gene: RHE_CH00191: Cytidine deaminase (EC 3.5.4.5) |
Gene: Atu0130: Cytidine deaminase (EC 3.5.4.5) |
Gene: Meso_3655: Cytidine deaminase (EC 3.5.4.5) |
Gene: mlr3158: Cytidine deaminase (EC 3.5.4.5) |
|
|
|
|
|
|
|
|
Cytidine deaminase (EC 3.5.4.5) |
| deoD |
Gene: SMc04123: Purine nucleoside phosphorylase (EC 2.4.2.1) |
Gene: NGR_c34540: Purine nucleoside phosphorylase (EC 2.4.2.1) |
Gene: RL0201: Purine nucleoside phosphorylase (EC 2.4.2.1) |
Gene: RHE_CH00192: Purine nucleoside phosphorylase (EC 2.4.2.1) |
Gene: Atu0131: Purine nucleoside phosphorylase (EC 2.4.2.1) |
Gene: Meso_3656: Purine nucleoside phosphorylase (EC 2.4.2.1) |
Gene: mlr3159: Purine nucleoside phosphorylase (EC 2.4.2.1) |
|
|
|
|
|
|
|
|
Purine nucleoside phosphorylase (EC 2.4.2.1) |
| deoC |
|
|
Gene: RL0202: Deoxyribose-phosphate aldolase (EC 4.1.2.4) |
Gene: RHE_CH00193: Deoxyribose-phosphate aldolase (EC 4.1.2.4) |
Gene: Atu0132: Deoxyribose-phosphate aldolase (EC 4.1.2.4) |
|
|
|
|
|
|
|
|
|
|
Deoxyribose-phosphate aldolase (EC 4.1.2.4) |
| deoA |
Gene: SMc04122: Thymidine phosphorylase (EC 2.4.2.4) |
Gene: NGR_c34550: Thymidine phosphorylase (EC 2.4.2.4) |
Gene: RL0203: Thymidine phosphorylase (EC 2.4.2.4) |
Gene: RHE_CH00194: Thymidine phosphorylase (EC 2.4.2.4) |
Gene: Atu0133: Thymidine phosphorylase (EC 2.4.2.4) |
Gene: Meso_3657: Thymidine phosphorylase (EC 2.4.2.4) |
Gene: mlr3160: Thymidine phosphorylase (EC 2.4.2.4) |
|
|
|
|
|
|
|
|
Thymidine phosphorylase (EC 2.4.2.4) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |