Regulon of RutR in Mesorhizobium sp. BNC1

Properties
Regulator type:	Transcription factor
TF locus tag:	Meso_2041
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Pyrimidine utilization
Effector:	Uracil
Regulog:	RutR - Rhizobiales
Statistics of regulated genes:
- Genes	16
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 44 sites [see more]

Member of regulog collections

By trascription factor - RutR
By taxonomy - Rhizobiales
By TF family - TetR
By effector - Uracil
By pathway - Pyrimidine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -64 Score: 5.6 Sequence: ATTTGACTGATTGATAAAAA Locus tag: Meso_2057 Name: pydX Funciton: Pyridine nucleotide-disulphide oxidoreductase associated with reductive pyrimidine catabolism Locus tag: Meso_2056 Name: Meso_2056 Funciton: Hypothetical protein Locus tag: Meso_2055 Name: pydA Funciton: Dihydropyrimidine dehydrogenase [NADP+] (EC 1.3.1.2)
	Meso_2057	pydX	Pyridine nucleotide-disulphide oxidoreductase associated with reductive pyrimidine catabolism
	Meso_2056	Meso_2056	Hypothetical protein
	Meso_2055	pydA	Dihydropyrimidine dehydrogenase [NADP+] (EC 1.3.1.2)
Position: -130 Score: 5.2 Sequence: TTTTGACCGTTTGGACAATC Locus tag: Meso_2041 Name: rutR Funciton: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
	Meso_2041	rutR	Transcriptional regulator RutR of pyrimidine catabolism, TetR family
Position: -18 Score: 5.3 Sequence: TGTTGACCAAAAGATAAAAT Locus tag: Meso_3652 Name: pntA Funciton: Predicted nucleoside ABC transporter, ATP-binding protein Locus tag: Meso_3653 Name: pntB Funciton: Predicted nucleoside ABC transporter, permease protein 1 Locus tag: Meso_3654 Name: pntC Funciton: Predicted nucleoside ABC transporter, permease protein 2 Locus tag: Meso_3655 Name: cdd Funciton: Cytidine deaminase (EC 3.5.4.5) Locus tag: Meso_3656 Name: deoD Funciton: Purine nucleoside phosphorylase (EC 2.4.2.1) Locus tag: Meso_3657 Name: deoA Funciton: Thymidine phosphorylase (EC 2.4.2.4)
	Meso_3652	pntA	Predicted nucleoside ABC transporter, ATP-binding protein
	Meso_3653	pntB	Predicted nucleoside ABC transporter, permease protein 1
	Meso_3654	pntC	Predicted nucleoside ABC transporter, permease protein 2
	Meso_3655	cdd	Cytidine deaminase (EC 3.5.4.5)
	Meso_3656	deoD	Purine nucleoside phosphorylase (EC 2.4.2.1)
	Meso_3657	deoA	Thymidine phosphorylase (EC 2.4.2.4)
Position: -88 Score: 4.9 Sequence: GATTGTCCAAACGGTCAAAA Locus tag: Meso_2042 Name: praX Funciton: Omega-amino acid--pyruvate aminotransferase (EC 2.6.1.18) Locus tag: Meso_2043 Name: pydC Funciton: Beta-ureidopropionase (EC 3.5.1.6) Locus tag: Meso_2044 Name: pytA Funciton: Pyrimidine ABC transporter ATP-binding protein Locus tag: Meso_2045 Name: pytB Funciton: Pyrimidine ABC transporter, permease protein 1 Locus tag: Meso_2046 Name: pytC Funciton: Pyrimidine ABC transporter, permease protein 2 Locus tag: Meso_2047 Name: pytD Funciton: Pyrimidine ABC transporter, substrate-binding protein
	Meso_2042	praX	Omega-amino acid--pyruvate aminotransferase (EC 2.6.1.18)
	Meso_2043	pydC	Beta-ureidopropionase (EC 3.5.1.6)
	Meso_2044	pytA	Pyrimidine ABC transporter ATP-binding protein
	Meso_2045	pytB	Pyrimidine ABC transporter, permease protein 1
	Meso_2046	pytC	Pyrimidine ABC transporter, permease protein 2
	Meso_2047	pytD	Pyrimidine ABC transporter, substrate-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of RutR in Mesorhizobium sp. BNC1

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --