Regulon of RutR in Rhizobium etli CFN 42

Properties
Regulator type:	Transcription factor
TF locus tag:	RHE_CH03289
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Pyrimidine utilization
Effector:	Uracil
Regulog:	RutR - Rhizobiales
Statistics of regulated genes:
- Genes	20
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 44 sites [see more]

Member of regulog collections

By trascription factor - RutR
By taxonomy - Rhizobiales
By TF family - TetR
By effector - Uracil
By pathway - Pyrimidine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -32 Score: 5.2 Sequence: TTTGAACCAGATGGTAAAAA Locus tag: RHE_PB00102 Name: pytM Funciton: Predicted pyrimidine ABC transporter, substrate-binding protein Locus tag: RHE_PB00103 Name: pytH Funciton: Predicted hydrolase Locus tag: RHE_PB00104 Name: pytN Funciton: Predicted pyrimidine ABC transporter, ATP-binding protein Locus tag: RHE_PB00105 Name: pytO Funciton: Predicted pyrimidine ABC transporter, permease protein 1 Locus tag: RHE_PB00106 Name: pytQ Funciton: Predicted pyrimidine ABC transporter, permease protein 2 Locus tag: RHE_PB00107 Name: codA Funciton: Cytosine deaminase (EC 3.5.4.1)
	RHE_PB00102	pytM	Predicted pyrimidine ABC transporter, substrate-binding protein
	RHE_PB00103	pytH	Predicted hydrolase
	RHE_PB00104	pytN	Predicted pyrimidine ABC transporter, ATP-binding protein
	RHE_PB00105	pytO	Predicted pyrimidine ABC transporter, permease protein 1
	RHE_PB00106	pytQ	Predicted pyrimidine ABC transporter, permease protein 2
	RHE_PB00107	codA	Cytosine deaminase (EC 3.5.4.1)
Position: -77 Score: 5.6 Sequence: ATTTTACCGTTTGATAAATT Locus tag: RHE_CH03277 Name: pydX Funciton: Pyridine nucleotide-disulphide oxidoreductase associated with reductive pyrimidine catabolism Locus tag: RHE_CH03278 Name: pydA Funciton: Dihydropyrimidine dehydrogenase [NADP+] (EC 1.3.1.2)
	RHE_CH03277	pydX	Pyridine nucleotide-disulphide oxidoreductase associated with reductive pyrimidine catabolism
	RHE_CH03278	pydA	Dihydropyrimidine dehydrogenase [NADP+] (EC 1.3.1.2)
Position: -154 Score: 4.8 Sequence: TCTTTACCGCCTGAAAAATT Locus tag: RHE_CH00187 Name: pntD Funciton: Predicted nucleoside ABC transporter, substrate-binding protein Locus tag: RHE_CH00188 Name: pntA Funciton: Predicted nucleoside ABC transporter, ATP-binding protein Locus tag: RHE_CH00189 Name: pntB Funciton: Predicted nucleoside ABC transporter, permease protein 1 Locus tag: RHE_CH00190 Name: pntC Funciton: Predicted nucleoside ABC transporter, permease protein 2 Locus tag: RHE_CH00191 Name: cdd Funciton: Cytidine deaminase (EC 3.5.4.5) Locus tag: RHE_CH00192 Name: deoD Funciton: Purine nucleoside phosphorylase (EC 2.4.2.1) Locus tag: RHE_CH00193 Name: deoC Funciton: Deoxyribose-phosphate aldolase (EC 4.1.2.4) Locus tag: RHE_CH00194 Name: deoA Funciton: Thymidine phosphorylase (EC 2.4.2.4)
	RHE_CH00187	pntD	Predicted nucleoside ABC transporter, substrate-binding protein
	RHE_CH00188	pntA	Predicted nucleoside ABC transporter, ATP-binding protein
	RHE_CH00189	pntB	Predicted nucleoside ABC transporter, permease protein 1
	RHE_CH00190	pntC	Predicted nucleoside ABC transporter, permease protein 2
	RHE_CH00191	cdd	Cytidine deaminase (EC 3.5.4.5)
	RHE_CH00192	deoD	Purine nucleoside phosphorylase (EC 2.4.2.1)
	RHE_CH00193	deoC	Deoxyribose-phosphate aldolase (EC 4.1.2.4)
	RHE_CH00194	deoA	Thymidine phosphorylase (EC 2.4.2.4)
Position: -163 Score: 5.9 Sequence: ATTTGACCGATTGGTAAACA Locus tag: RHE_CH03289 Name: rutR Funciton: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
	RHE_CH03289	rutR	Transcriptional regulator RutR of pyrimidine catabolism, TetR family
Position: -156 Score: 5.6 Sequence: TGTTTACCAATCGGTCAAAT Locus tag: RHE_CH03290 Name: pydC Funciton: Beta-ureidopropionase (EC 3.5.1.6) Locus tag: RHE_CH03291 Name: RL3717 Funciton: Hypothetical protein Locus tag: RHE_CH03292 Name: pydB Funciton: Dihydropyrimidinase (EC 3.5.2.2)
	RHE_CH03290	pydC	Beta-ureidopropionase (EC 3.5.1.6)
	RHE_CH03291	RL3717	Hypothetical protein
	RHE_CH03292	pydB	Dihydropyrimidinase (EC 3.5.2.2)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of RutR in Rhizobium etli CFN 42

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --