Regulog RutR - Oceanospirillales/Alteromonadales
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Pyrimidine utilization |
| Effector: | Uracil |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By trascription factor - RutR
- By taxonomy - Oceanospirillales/Alteromonadales
- By TF family - TetR
- By effector - Uracil
- By pathway - Pyrimidine utilization
| Genome | Genes | Operons |
|---|---|---|
| Hahella chejuensis KCTC 2396 | 21 | 4 |
| Marinobacter aqueolei | ||
| Marinobacter sp. ELB17 | 5 | 3 |
| Oceanobacter sp. RED65 | 11 | 3 |
| Oceanospirillum sp. MED92 | ||
| Marinomonas sp. MWYL1 | 14 | 5 |
| Saccharophagus degradans 2-40 | ||
| Teredinibacter turnerae T7901 | 11 | 3 |
| Cellvibrio japonicus Ueda107 | 14 | 3 |
| Chromohalobacter salexigens DSM 3043 | 4 | 2 |
| Reinekea sp. MED297 | 11 | 3 |
| Alcanivorax borkumensis SK2 |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| xdhA |
*
Hahella chejuensis KCTC 2396 Site: position = -157 score = 5.22625 sequence = ACCTGACCATGTAGACAAGT Gene: HCH_01099: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4) |
|
*
Marinobacter sp. ELB17 Site: position = -196 score = 5.22433 sequence = ACTAGACTATTTGGTCAGGT Gene: MELB17_16808: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4) |
*
Oceanobacter sp. RED65 Site: position = -230 score = 5.42876 sequence = AACTGACCATATGGACAGAA Site: position = -125 score = 5.70112 sequence = AGCTGACTAATTGGTCAGAT Gene: RED65_04290: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4) |
|
*
Marinomonas sp. MWYL1 Site: position = -83 score = 4.96178 sequence = ATTTGTACGATTGGTCAGGT Gene: Mmwyl1_2699: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4) |
|
*
Teredinibacter turnerae T7901 Site: position = -252 score = 4.66985 sequence = ATTTGACCACTAGGACAAAT Site: position = -89 score = 5.64764 sequence = ACCTGACCGAATGGCCAGCT Gene: TERTU_2067: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4) |
*
Cellvibrio japonicus Ueda107 Site: position = -201 score = 4.84897 sequence = ACCTGACTGCACGGACAAAA Site: position = -77 score = 4.16204 sequence = AATTGTCTATTTGGCCAGTC Gene: CJA_0546: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4) |
*
Chromohalobacter salexigens DSM 3043 Site: position = -75 score = 4.98954 sequence = AGTTGACCAGATGGTCATAC Gene: Csal_1789: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4) |
*
Reinekea sp. MED297 Site: position = -147 score = 5.86323 sequence = ACCTGACCGCATGGTCAGCT Gene: MED297_08316: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4) |
|
Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4) |
| xdhB |
Gene: HCH_01098: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4) |
|
Gene: MELB17_16813: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4) |
Gene: RED65_04295: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4) |
|
Gene: Mmwyl1_2698: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4) |
|
Gene: TERTU_2066: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4) |
Gene: CJA_0547: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4) |
Gene: Csal_1788: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4) |
Gene: MED297_08321: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4) |
|
Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4) |
| xdhC |
Gene: HCH_01097: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase) |
|
Gene: MELB17_16818: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase) |
Gene: RED65_04300: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase) |
|
Gene: Mmwyl1_2697: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase) |
|
Gene: TERTU_2065: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase) |
Gene: CJA_0548: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase) |
Gene: Csal_1787: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase) |
Gene: MED297_08326: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase) |
|
XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase) |
| allB |
Gene: HCH_01096: Allantoinase (EC 3.5.2.5) |
|
|
|
|
|
|
|
|
|
Gene: MED297_08331: Allantoinase (EC 3.5.2.5) |
|
Allantoinase (EC 3.5.2.5) |
| allC |
Gene: HCH_01095: Allantoicase (EC 3.5.3.4) |
|
|
Gene: RED65_04305: Allantoicase (EC 3.5.3.4) |
|
|
|
|
|
|
|
|
Allantoicase (EC 3.5.3.4) |
| pucL |
Gene: HCH_01094: Uricase (EC 1.7.3.3) |
|
|
Gene: RED65_04310: Uricase (EC 1.7.3.3) |
|
|
|
Gene: TERTU_2064: Uricase (EC 1.7.3.3) |
Gene: CJA_0549: Uricase (EC 1.7.3.3) |
|
Gene: MED297_08336: Uricase (EC 1.7.3.3) |
|
Uricase (EC 1.7.3.3) |
| pucM |
Gene: HCH_01093: Hydroxyisourate hydrolase (EC 3.5.2.17) |
|
|
Gene: RED65_04315: Hydroxyisourate hydrolase (EC 3.5.2.17) |
|
|
|
Gene: TERTU_2063: Hydroxyisourate hydrolase (EC 3.5.2.17) |
Gene: CJA_0550: Hydroxyisourate hydrolase (EC 3.5.2.17) |
|
Gene: MED297_08341: Hydroxyisourate hydrolase (EC 3.5.2.17) |
|
Hydroxyisourate hydrolase (EC 3.5.2.17) |
| allA |
Gene: HCH_01092: Ureidoglycolate hydrolase (EC 3.5.3.19) |
|
|
Gene: RED65_04320: Ureidoglycolate hydrolase (EC 3.5.3.19) |
|
|
|
|
|
|
|
|
Ureidoglycolate hydrolase (EC 3.5.3.19) |
| guaD |
Gene: HCH_01091: Guanine deaminase (EC 3.5.4.3) |
|
*
Marinobacter sp. ELB17 Site: position = -114 score = 4.49207 sequence = TGCTGACTTAGTGGTCAAGT Gene: MELB17_16798: Guanine deaminase (EC 3.5.4.3) |
Gene: RED65_04325: Guanine deaminase (EC 3.5.4.3) |
|
*
Marinomonas sp. MWYL1 Site: position = -62 score = 4.00852 sequence = GTATAACCATTCGGTCAAAC Gene: Mmwyl1_1677: Guanine deaminase (EC 3.5.4.3) |
|
Gene: TERTU_2062: Guanine deaminase (EC 3.5.4.3) |
Gene: CJA_0551: Guanine deaminase (EC 3.5.4.3) |
|
*
Reinekea sp. MED297 Site: position = -156 score = 4.33158 sequence = TGTTGACCATGTGGTTAGGA Gene: MED297_06818: Guanine deaminase (EC 3.5.4.3) |
|
Guanine deaminase (EC 3.5.4.3) |
| COG3748 |
Gene: HCH_01090: Predicted inner membrane protein |
|
|
Gene: RED65_04330: Predicted inner membrane protein |
|
|
|
Gene: TERTU_2061: Predicted inner membrane protein |
Gene: CJA_0552: Predicted inner membrane protein |
|
Gene: MED297_08346: Predicted inner membrane protein |
|
Predicted inner membrane protein |
| CRON 2. | |||||||||||||
| hpt |
Gene: HCH_03840: Hypoxanthine-guanine phosphoribosyltransferase (EC 2.4.2.8) |
|
|
Gene: RED65_15473: Hypoxanthine-guanine phosphoribosyltransferase (EC 2.4.2.8) |
Gene: MED92_03213: Hypoxanthine-guanine phosphoribosyltransferase (EC 2.4.2.8) |
|
|
*
Teredinibacter turnerae T7901 Site: position = -96 score = 5.79743 sequence = TTCTGACCAAATGGTCAGCT Gene: TERTU_2072: Hypoxanthine-guanine phosphoribosyltransferase (EC 2.4.2.8) |
Gene: CJA_0580: Hypoxanthine-guanine phosphoribosyltransferase (EC 2.4.2.8) |
|
Gene: MED297_18333: Hypoxanthine-guanine phosphoribosyltransferase (EC 2.4.2.8) |
|
Hypoxanthine-guanine phosphoribosyltransferase (EC 2.4.2.8) |
| nupP |
|
|
|
|
|
|
|
Gene: TERTU_2071: Predicted purine nucleoside permease |
*
Cellvibrio japonicus Ueda107 Site: position = -70 score = 4.35473 sequence = ATCCATCCAAATGGTCAATT Gene: CJA_0583: Predicted purine nucleoside permease |
|
|
|
Predicted purine nucleoside permease |
| CRON 3. | |||||||||||||
| pbuT |
|
|
|
*
Oceanobacter sp. RED65 Site: position = -127 score = 4.36979 sequence = TTTTAACCCTCTGGTCAGGT Gene: RED65_12897: Xanthine/uracil permease |
|
*
Marinomonas sp. MWYL1 Site: position = -117 score = 4.85931 sequence = TACTGACCAAATGATCAGTT Gene: Mmwyl1_1566: Xanthine/uracil permease |
|
|
|
|
|
|
Xanthine/uracil permease |
| CRON 4. | |||||||||||||
| ppuA |
*2
Hahella chejuensis KCTC 2396 Site: position = -235 score = 5.2023 sequence = AGTTGATCAATTGGTCAAAT Site: position = -208 score = 5.03013 sequence = AACTGACCAGTTGGCCAAAA Gene: HCH_01101: Predicted ABC transporter, ATP-binding protein Site: position = -111 score = 5.10681 sequence = TCTTGACTACTTGGTCAGAA Gene: HCH_02310: Predicted ABC transporter, ATP-binding protein |
|
|
|
|
*2
Marinomonas sp. MWYL1 Site: position = -185 score = 4.46966 sequence = TATTAACTAGTCGGTCAGAT Gene: Mmwyl1_1926: Predicted ABC transporter, ATP-binding protein Gene: Mmwyl1_0633: Predicted ABC transporter, ATP-binding protein |
|
|
*
Cellvibrio japonicus Ueda107 Site: position = -165 score = 4.51594 sequence = GACTGGCCAAATAGACAATT Site: position = -41 score = 4.42269 sequence = TTTTGTCCGTGCAGTCAGGT Gene: CJA_0545: Predicted ABC transporter, ATP-binding protein |
|
*
Reinekea sp. MED297 Site: position = -2 score = 4.30815 sequence = TCATGACTGCTCAGACAGAT Gene: MED297_21307: Predicted ABC transporter, ATP-binding protein |
|
Predicted ABC transporter, ATP-binding protein |
| ppuC |
2
Hahella chejuensis KCTC 2396 Gene: HCH_01102: Predicted ABC transporter, permease protein Gene: HCH_02311: Predicted ABC transporter, permease protein |
|
|
|
|
2
Marinomonas sp. MWYL1 Gene: Mmwyl1_1925: Predicted ABC transporter, permease protein Gene: Mmwyl1_0634: Predicted ABC transporter, permease protein |
|
|
Gene: CJA_0544: Predicted ABC transporter, permease protein |
|
Gene: MED297_21302: Predicted ABC transporter, permease protein |
|
Predicted ABC transporter, permease protein |
| ppuD |
2
Hahella chejuensis KCTC 2396 Gene: HCH_01103: Predicted ABC transporter, inner membrane protein precursor Gene: HCH_02312: Predicted ABC transporter, inner membrane protein precursor |
|
|
|
|
2
Marinomonas sp. MWYL1 Gene: Mmwyl1_1924: Predicted ABC transporter, inner membrane protein precursor Gene: Mmwyl1_0635: Predicted ABC transporter, inner membrane protein precursor |
|
|
Gene: CJA_0543: Predicted ABC transporter, inner membrane protein precursor |
|
Gene: MED297_21297: Predicted ABC transporter, inner membrane protein precursor |
|
Predicted ABC transporter, inner membrane protein precursor |
| ppuB |
*2
Hahella chejuensis KCTC 2396 Gene: HCH_01105: Predicted ABC transporter, substrate-binding protein precursor Site: position = -106 score = 5.03421 sequence = ACCTGTCCGGCTGGTCATAA Gene: HCH_01504: Predicted ABC transporter, substrate-binding protein precursor |
|
|
|
|
*2
Marinomonas sp. MWYL1 Gene: Mmwyl1_1923: Predicted ABC transporter, substrate-binding protein precursor Site: position = -64 score = 4.05008 sequence = TTTTGACCAGTTAGGCAGGG Gene: Mmwyl1_0632: Predicted ABC transporter, substrate-binding protein precursor |
|
|
Gene: CJA_0542: Predicted ABC transporter, substrate-binding protein precursor |
|
|
|
Predicted ABC transporter, substrate-binding protein precursor |
| ssnA |
Gene: HCH_01106: Predicted chlorohydrolase/aminohydrolase |
|
|
|
|
|
|
Gene: TERTU_2070: Predicted chlorohydrolase/aminohydrolase |
Gene: CJA_0540: Predicted chlorohydrolase/aminohydrolase |
|
|
|
Predicted chlorohydrolase/aminohydrolase |
| rutR |
Gene: HCH_01108: Transcriptional regulator RutR of pyrimidine catabolism, TetR family |
|
*
Marinobacter sp. ELB17 Site: position = -240 score = 5.32593 sequence = ACCTGACCAAATAGTCTAGT Gene: MELB17_16803: Transcriptional regulator RutR of pyrimidine catabolism, TetR family |
Gene: RED65_04280: Transcriptional regulator RutR of pyrimidine catabolism, TetR family |
|
Gene: Mmwyl1_1423: Transcriptional regulator RutR of pyrimidine catabolism, TetR family |
|
*
Teredinibacter turnerae T7901 Site: position = -72 score = 4.57341 sequence = ATTTGTCCTAGTGGTCAAAT Site: position = -235 score = 5.31474 sequence = AGCTGGCCATTCGGTCAGGT Gene: TERTU_2069: Transcriptional regulator RutR of pyrimidine catabolism, TetR family |
Gene: CJA_0541: Transcriptional regulator RutR of pyrimidine catabolism, TetR family |
*
Chromohalobacter salexigens DSM 3043 Site: position = -87 score = 4.98392 sequence = GTATGACCATCTGGTCAACT Gene: Csal_1790: Transcriptional regulator RutR of pyrimidine catabolism, TetR family |
Gene: MED297_01515: Transcriptional regulator RutR of pyrimidine catabolism, TetR family |
|
Transcriptional regulator RutR of pyrimidine catabolism, TetR family |
| add |
Gene: HCH_01503: Adenosine deaminase (EC 3.5.4.4) |
|
Gene: MELB17_16728: Adenosine deaminase (EC 3.5.4.4) |
*
Oceanobacter sp. RED65 Site: position = -35 score = 4.88894 sequence = TCCTGATCAGATAGTCAATT Gene: RED65_11380: Adenosine deaminase (EC 3.5.4.4) |
|
Gene: Mmwyl1_1922: Adenosine deaminase (EC 3.5.4.4) |
|
Gene: TERTU_3230: Adenosine deaminase (EC 3.5.4.4) |
|
Gene: Csal_1983: Adenosine deaminase (EC 3.5.4.4) |
|
|
Adenosine deaminase (EC 3.5.4.4) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |