Statistics of regulated genes

Genome	Genes	Operons
Hahella chejuensis KCTC 2396	21	4
Marinobacter aqueolei
Marinobacter sp. ELB17	5	3
Oceanobacter sp. RED65	11	3
Oceanospirillum sp. MED92
Marinomonas sp. MWYL1	14	5
Saccharophagus degradans 2-40
Teredinibacter turnerae T7901	11	3
Cellvibrio japonicus Ueda107	14	3
Chromohalobacter salexigens DSM 3043	4	2
Reinekea sp. MED297	11	3
Alcanivorax borkumensis SK2

Clusters of co-Regulated Orthologous operoNs (CRONs)

Genes													Function
CRON 1.
xdhA	* Hahella chejuensis KCTC 2396 Site: position = -157 score = 5.22625 sequence = ACCTGACCATGTAGACAAGT Gene: HCH_01099: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4)	Marinobacter aqueolei	* Marinobacter sp. ELB17 Site: position = -196 score = 5.22433 sequence = ACTAGACTATTTGGTCAGGT Gene: MELB17_16808: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4)	* Oceanobacter sp. RED65 Site: position = -230 score = 5.42876 sequence = AACTGACCATATGGACAGAA Site: position = -125 score = 5.70112 sequence = AGCTGACTAATTGGTCAGAT Gene: RED65_04290: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4)	Oceanospirillum sp. MED92	* Marinomonas sp. MWYL1 Site: position = -83 score = 4.96178 sequence = ATTTGTACGATTGGTCAGGT Gene: Mmwyl1_2699: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4)	Saccharophagus degradans 2-40	* Teredinibacter turnerae T7901 Site: position = -252 score = 4.66985 sequence = ATTTGACCACTAGGACAAAT Site: position = -89 score = 5.64764 sequence = ACCTGACCGAATGGCCAGCT Gene: TERTU_2067: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4)	* Cellvibrio japonicus Ueda107 Site: position = -201 score = 4.84897 sequence = ACCTGACTGCACGGACAAAA Site: position = -77 score = 4.16204 sequence = AATTGTCTATTTGGCCAGTC Gene: CJA_0546: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4)	* Chromohalobacter salexigens DSM 3043 Site: position = -75 score = 4.98954 sequence = AGTTGACCAGATGGTCATAC Gene: Csal_1789: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4)	* Reinekea sp. MED297 Site: position = -147 score = 5.86323 sequence = ACCTGACCGCATGGTCAGCT Gene: MED297_08316: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4)	Alcanivorax borkumensis SK2	Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4)
xdhB	Hahella chejuensis KCTC 2396 Gene: HCH_01098: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4)	Marinobacter aqueolei	Marinobacter sp. ELB17 Gene: MELB17_16813: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4)	Oceanobacter sp. RED65 Gene: RED65_04295: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4)	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1 Gene: Mmwyl1_2698: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4)	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901 Gene: TERTU_2066: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4)	Cellvibrio japonicus Ueda107 Gene: CJA_0547: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4)	Chromohalobacter salexigens DSM 3043 Gene: Csal_1788: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4)	Reinekea sp. MED297 Gene: MED297_08321: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4)	Alcanivorax borkumensis SK2	Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4)
xdhC	Hahella chejuensis KCTC 2396 Gene: HCH_01097: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase)	Marinobacter aqueolei	Marinobacter sp. ELB17 Gene: MELB17_16818: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase)	Oceanobacter sp. RED65 Gene: RED65_04300: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase)	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1 Gene: Mmwyl1_2697: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase)	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901 Gene: TERTU_2065: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase)	Cellvibrio japonicus Ueda107 Gene: CJA_0548: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase)	Chromohalobacter salexigens DSM 3043 Gene: Csal_1787: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase)	Reinekea sp. MED297 Gene: MED297_08326: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase)	Alcanivorax borkumensis SK2	XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase)
allB	Hahella chejuensis KCTC 2396 Gene: HCH_01096: Allantoinase (EC 3.5.2.5)	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297 Gene: MED297_08331: Allantoinase (EC 3.5.2.5)	Alcanivorax borkumensis SK2	Allantoinase (EC 3.5.2.5)
allC	Hahella chejuensis KCTC 2396 Gene: HCH_01095: Allantoicase (EC 3.5.3.4)	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65 Gene: RED65_04305: Allantoicase (EC 3.5.3.4)	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297	Alcanivorax borkumensis SK2	Allantoicase (EC 3.5.3.4)
pucL	Hahella chejuensis KCTC 2396 Gene: HCH_01094: Uricase (EC 1.7.3.3)	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65 Gene: RED65_04310: Uricase (EC 1.7.3.3)	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901 Gene: TERTU_2064: Uricase (EC 1.7.3.3)	Cellvibrio japonicus Ueda107 Gene: CJA_0549: Uricase (EC 1.7.3.3)	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297 Gene: MED297_08336: Uricase (EC 1.7.3.3)	Alcanivorax borkumensis SK2	Uricase (EC 1.7.3.3)
pucM	Hahella chejuensis KCTC 2396 Gene: HCH_01093: Hydroxyisourate hydrolase (EC 3.5.2.17)	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65 Gene: RED65_04315: Hydroxyisourate hydrolase (EC 3.5.2.17)	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901 Gene: TERTU_2063: Hydroxyisourate hydrolase (EC 3.5.2.17)	Cellvibrio japonicus Ueda107 Gene: CJA_0550: Hydroxyisourate hydrolase (EC 3.5.2.17)	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297 Gene: MED297_08341: Hydroxyisourate hydrolase (EC 3.5.2.17)	Alcanivorax borkumensis SK2	Hydroxyisourate hydrolase (EC 3.5.2.17)
allA	Hahella chejuensis KCTC 2396 Gene: HCH_01092: Ureidoglycolate hydrolase (EC 3.5.3.19)	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65 Gene: RED65_04320: Ureidoglycolate hydrolase (EC 3.5.3.19)	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297	Alcanivorax borkumensis SK2	Ureidoglycolate hydrolase (EC 3.5.3.19)
guaD	Hahella chejuensis KCTC 2396 Gene: HCH_01091: Guanine deaminase (EC 3.5.4.3)	Marinobacter aqueolei	* Marinobacter sp. ELB17 Site: position = -114 score = 4.49207 sequence = TGCTGACTTAGTGGTCAAGT Gene: MELB17_16798: Guanine deaminase (EC 3.5.4.3)	Oceanobacter sp. RED65 Gene: RED65_04325: Guanine deaminase (EC 3.5.4.3)	Oceanospirillum sp. MED92	* Marinomonas sp. MWYL1 Site: position = -62 score = 4.00852 sequence = GTATAACCATTCGGTCAAAC Gene: Mmwyl1_1677: Guanine deaminase (EC 3.5.4.3)	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901 Gene: TERTU_2062: Guanine deaminase (EC 3.5.4.3)	Cellvibrio japonicus Ueda107 Gene: CJA_0551: Guanine deaminase (EC 3.5.4.3)	Chromohalobacter salexigens DSM 3043	* Reinekea sp. MED297 Site: position = -156 score = 4.33158 sequence = TGTTGACCATGTGGTTAGGA Gene: MED297_06818: Guanine deaminase (EC 3.5.4.3)	Alcanivorax borkumensis SK2	Guanine deaminase (EC 3.5.4.3)
COG3748	Hahella chejuensis KCTC 2396 Gene: HCH_01090: Predicted inner membrane protein	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65 Gene: RED65_04330: Predicted inner membrane protein	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901 Gene: TERTU_2061: Predicted inner membrane protein	Cellvibrio japonicus Ueda107 Gene: CJA_0552: Predicted inner membrane protein	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297 Gene: MED297_08346: Predicted inner membrane protein	Alcanivorax borkumensis SK2	Predicted inner membrane protein
CRON 2.
hpt	Hahella chejuensis KCTC 2396 Gene: HCH_03840: Hypoxanthine-guanine phosphoribosyltransferase (EC 2.4.2.8)	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65 Gene: RED65_15473: Hypoxanthine-guanine phosphoribosyltransferase (EC 2.4.2.8)	Oceanospirillum sp. MED92 Gene: MED92_03213: Hypoxanthine-guanine phosphoribosyltransferase (EC 2.4.2.8)	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40	* Teredinibacter turnerae T7901 Site: position = -96 score = 5.79743 sequence = TTCTGACCAAATGGTCAGCT Gene: TERTU_2072: Hypoxanthine-guanine phosphoribosyltransferase (EC 2.4.2.8)	Cellvibrio japonicus Ueda107 Gene: CJA_0580: Hypoxanthine-guanine phosphoribosyltransferase (EC 2.4.2.8)	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297 Gene: MED297_18333: Hypoxanthine-guanine phosphoribosyltransferase (EC 2.4.2.8)	Alcanivorax borkumensis SK2	Hypoxanthine-guanine phosphoribosyltransferase (EC 2.4.2.8)
nupP	Hahella chejuensis KCTC 2396	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901 Gene: TERTU_2071: Predicted purine nucleoside permease	* Cellvibrio japonicus Ueda107 Site: position = -70 score = 4.35473 sequence = ATCCATCCAAATGGTCAATT Gene: CJA_0583: Predicted purine nucleoside permease	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297	Alcanivorax borkumensis SK2	Predicted purine nucleoside permease
CRON 3.
pbuT	Hahella chejuensis KCTC 2396	Marinobacter aqueolei	Marinobacter sp. ELB17	* Oceanobacter sp. RED65 Site: position = -127 score = 4.36979 sequence = TTTTAACCCTCTGGTCAGGT Gene: RED65_12897: Xanthine/uracil permease	Oceanospirillum sp. MED92	* Marinomonas sp. MWYL1 Site: position = -117 score = 4.85931 sequence = TACTGACCAAATGATCAGTT Gene: Mmwyl1_1566: Xanthine/uracil permease	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297	Alcanivorax borkumensis SK2	Xanthine/uracil permease
CRON 4.
ppuA	*2 Hahella chejuensis KCTC 2396 Site: position = -235 score = 5.2023 sequence = AGTTGATCAATTGGTCAAAT Site: position = -208 score = 5.03013 sequence = AACTGACCAGTTGGCCAAAA Gene: HCH_01101: Predicted ABC transporter, ATP-binding protein Site: position = -111 score = 5.10681 sequence = TCTTGACTACTTGGTCAGAA Gene: HCH_02310: Predicted ABC transporter, ATP-binding protein	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	*2 Marinomonas sp. MWYL1 Site: position = -185 score = 4.46966 sequence = TATTAACTAGTCGGTCAGAT Gene: Mmwyl1_1926: Predicted ABC transporter, ATP-binding protein Gene: Mmwyl1_0633: Predicted ABC transporter, ATP-binding protein	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	* Cellvibrio japonicus Ueda107 Site: position = -165 score = 4.51594 sequence = GACTGGCCAAATAGACAATT Site: position = -41 score = 4.42269 sequence = TTTTGTCCGTGCAGTCAGGT Gene: CJA_0545: Predicted ABC transporter, ATP-binding protein	Chromohalobacter salexigens DSM 3043	* Reinekea sp. MED297 Site: position = -2 score = 4.30815 sequence = TCATGACTGCTCAGACAGAT Gene: MED297_21307: Predicted ABC transporter, ATP-binding protein	Alcanivorax borkumensis SK2	Predicted ABC transporter, ATP-binding protein
ppuC	2 Hahella chejuensis KCTC 2396 Gene: HCH_01102: Predicted ABC transporter, permease protein Gene: HCH_02311: Predicted ABC transporter, permease protein	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	2 Marinomonas sp. MWYL1 Gene: Mmwyl1_1925: Predicted ABC transporter, permease protein Gene: Mmwyl1_0634: Predicted ABC transporter, permease protein	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107 Gene: CJA_0544: Predicted ABC transporter, permease protein	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297 Gene: MED297_21302: Predicted ABC transporter, permease protein	Alcanivorax borkumensis SK2	Predicted ABC transporter, permease protein
ppuD	2 Hahella chejuensis KCTC 2396 Gene: HCH_01103: Predicted ABC transporter, inner membrane protein precursor Gene: HCH_02312: Predicted ABC transporter, inner membrane protein precursor	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	2 Marinomonas sp. MWYL1 Gene: Mmwyl1_1924: Predicted ABC transporter, inner membrane protein precursor Gene: Mmwyl1_0635: Predicted ABC transporter, inner membrane protein precursor	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107 Gene: CJA_0543: Predicted ABC transporter, inner membrane protein precursor	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297 Gene: MED297_21297: Predicted ABC transporter, inner membrane protein precursor	Alcanivorax borkumensis SK2	Predicted ABC transporter, inner membrane protein precursor
ppuB	*2 Hahella chejuensis KCTC 2396 Gene: HCH_01105: Predicted ABC transporter, substrate-binding protein precursor Site: position = -106 score = 5.03421 sequence = ACCTGTCCGGCTGGTCATAA Gene: HCH_01504: Predicted ABC transporter, substrate-binding protein precursor	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	*2 Marinomonas sp. MWYL1 Gene: Mmwyl1_1923: Predicted ABC transporter, substrate-binding protein precursor Site: position = -64 score = 4.05008 sequence = TTTTGACCAGTTAGGCAGGG Gene: Mmwyl1_0632: Predicted ABC transporter, substrate-binding protein precursor	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107 Gene: CJA_0542: Predicted ABC transporter, substrate-binding protein precursor	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297	Alcanivorax borkumensis SK2	Predicted ABC transporter, substrate-binding protein precursor
ssnA	Hahella chejuensis KCTC 2396 Gene: HCH_01106: Predicted chlorohydrolase/aminohydrolase	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901 Gene: TERTU_2070: Predicted chlorohydrolase/aminohydrolase	Cellvibrio japonicus Ueda107 Gene: CJA_0540: Predicted chlorohydrolase/aminohydrolase	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297	Alcanivorax borkumensis SK2	Predicted chlorohydrolase/aminohydrolase
rutR	Hahella chejuensis KCTC 2396 Gene: HCH_01108: Transcriptional regulator RutR of pyrimidine catabolism, TetR family	Marinobacter aqueolei	* Marinobacter sp. ELB17 Site: position = -240 score = 5.32593 sequence = ACCTGACCAAATAGTCTAGT Gene: MELB17_16803: Transcriptional regulator RutR of pyrimidine catabolism, TetR family	Oceanobacter sp. RED65 Gene: RED65_04280: Transcriptional regulator RutR of pyrimidine catabolism, TetR family	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1 Gene: Mmwyl1_1423: Transcriptional regulator RutR of pyrimidine catabolism, TetR family	Saccharophagus degradans 2-40	* Teredinibacter turnerae T7901 Site: position = -72 score = 4.57341 sequence = ATTTGTCCTAGTGGTCAAAT Site: position = -235 score = 5.31474 sequence = AGCTGGCCATTCGGTCAGGT Gene: TERTU_2069: Transcriptional regulator RutR of pyrimidine catabolism, TetR family	Cellvibrio japonicus Ueda107 Gene: CJA_0541: Transcriptional regulator RutR of pyrimidine catabolism, TetR family	* Chromohalobacter salexigens DSM 3043 Site: position = -87 score = 4.98392 sequence = GTATGACCATCTGGTCAACT Gene: Csal_1790: Transcriptional regulator RutR of pyrimidine catabolism, TetR family	Reinekea sp. MED297 Gene: MED297_01515: Transcriptional regulator RutR of pyrimidine catabolism, TetR family	Alcanivorax borkumensis SK2	Transcriptional regulator RutR of pyrimidine catabolism, TetR family
add	Hahella chejuensis KCTC 2396 Gene: HCH_01503: Adenosine deaminase (EC 3.5.4.4)	Marinobacter aqueolei	Marinobacter sp. ELB17 Gene: MELB17_16728: Adenosine deaminase (EC 3.5.4.4)	* Oceanobacter sp. RED65 Site: position = -35 score = 4.88894 sequence = TCCTGATCAGATAGTCAATT Gene: RED65_11380: Adenosine deaminase (EC 3.5.4.4)	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1 Gene: Mmwyl1_1922: Adenosine deaminase (EC 3.5.4.4)	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901 Gene: TERTU_3230: Adenosine deaminase (EC 3.5.4.4)	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043 Gene: Csal_1983: Adenosine deaminase (EC 3.5.4.4)	Reinekea sp. MED297	Alcanivorax borkumensis SK2	Adenosine deaminase (EC 3.5.4.4)

Export

	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD