Regulon of RutR in Marinobacter sp. ELB17

Properties
Regulator type:	Transcription factor
TF locus tag:	MELB17_16803
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Pyrimidine utilization
Effector:	Uracil
Regulog:	RutR - Oceanospirillales/Alteromonadales
Statistics of regulated genes:
- Genes	5
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 32 sites [see more]

Member of regulog collections

By trascription factor - RutR
By taxonomy - Oceanospirillales/Alteromonadales
By TF family - TetR
By effector - Uracil
By pathway - Pyrimidine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -114 Score: 4.5 Sequence: TGCTGACTTAGTGGTCAAGT Locus tag: MELB17_16798 Name: guaD Funciton: Guanine deaminase (EC 3.5.4.3)
	MELB17_16798	guaD	Guanine deaminase (EC 3.5.4.3)
Position: -196 Score: 5.2 Sequence: ACTAGACTATTTGGTCAGGT Locus tag: MELB17_16808 Name: xdhA Funciton: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4) Locus tag: MELB17_16813 Name: xdhB Funciton: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4) Locus tag: MELB17_16818 Name: xdhC Funciton: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase)
	MELB17_16808	xdhA	Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4)
	MELB17_16813	xdhB	Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4)
	MELB17_16818	xdhC	XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase)
Position: -240 Score: 5.3 Sequence: ACCTGACCAAATAGTCTAGT Locus tag: MELB17_16803 Name: rutR Funciton: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
	MELB17_16803	rutR	Transcriptional regulator RutR of pyrimidine catabolism, TetR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD