Regulon of RutR in Teredinibacter turnerae T7901

Properties
Regulator type:	Transcription factor
TF locus tag:	TERTU_2069
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Pyrimidine utilization
Effector:	Uracil
Regulog:	RutR - Oceanospirillales/Alteromonadales
Statistics of regulated genes:
- Genes	11
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 32 sites [see more]

Member of regulog collections

By trascription factor - RutR
By taxonomy - Oceanospirillales/Alteromonadales
By TF family - TetR
By effector - Uracil
By pathway - Pyrimidine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -252 Score: 4.7 Sequence: ATTTGACCACTAGGACAAAT Position: -89 Score: 5.6 Sequence: ACCTGACCGAATGGCCAGCT Locus tag: TERTU_2067 Name: xdhA Funciton: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4) Locus tag: TERTU_2066 Name: xdhB Funciton: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4) Locus tag: TERTU_2065 Name: xdhC Funciton: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase) Locus tag: TERTU_2064 Name: pucL Funciton: Uricase (EC 1.7.3.3) Locus tag: TERTU_2063 Name: pucM Funciton: Hydroxyisourate hydrolase (EC 3.5.2.17) Locus tag: TERTU_2062 Name: guaD Funciton: Guanine deaminase (EC 3.5.4.3) Locus tag: TERTU_2061 Name: COG3748 Funciton: Predicted inner membrane protein
	TERTU_2067	xdhA	Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4)
	TERTU_2066	xdhB	Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4)
	TERTU_2065	xdhC	XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase)
	TERTU_2064	pucL	Uricase (EC 1.7.3.3)
	TERTU_2063	pucM	Hydroxyisourate hydrolase (EC 3.5.2.17)
	TERTU_2062	guaD	Guanine deaminase (EC 3.5.4.3)
	TERTU_2061	COG3748	Predicted inner membrane protein
Position: -96 Score: 5.8 Sequence: TTCTGACCAAATGGTCAGCT Locus tag: TERTU_2072 Name: hpt Funciton: Hypoxanthine-guanine phosphoribosyltransferase (EC 2.4.2.8) Locus tag: TERTU_2071 Name: nupP Funciton: Predicted purine nucleoside permease
	TERTU_2072	hpt	Hypoxanthine-guanine phosphoribosyltransferase (EC 2.4.2.8)
	TERTU_2071	nupP	Predicted purine nucleoside permease
Position: -235 Score: 5.3 Sequence: AGCTGGCCATTCGGTCAGGT Position: -72 Score: 4.6 Sequence: ATTTGTCCTAGTGGTCAAAT Locus tag: TERTU_2069 Name: rutR Funciton: Transcriptional regulator RutR of pyrimidine catabolism, TetR family Locus tag: TERTU_2070 Name: ssnA Funciton: Predicted chlorohydrolase/aminohydrolase
	TERTU_2069	rutR	Transcriptional regulator RutR of pyrimidine catabolism, TetR family
	TERTU_2070	ssnA	Predicted chlorohydrolase/aminohydrolase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD