Orthologous regulated operons containing allB gene

Properties
Regulog:	RutR - Oceanospirillales/Alteromonadales
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Pyrimidine utilization
Effector:	Uracil
Phylum:	Proteobacteria/gamma

Built upon 32 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Hahella chejuensis KCTC 2396
Position: -157 Score: 5.22625 Sequence: ACCTGACCATGTAGACAAGT Locus tag: HCH_01099 Name: xdhA Funciton: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4) Locus tag: HCH_01098 Name: xdhB Funciton: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4) Locus tag: HCH_01097 Name: xdhC Funciton: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase) Locus tag: HCH_01096 Name: allB Funciton: Allantoinase (EC 3.5.2.5) Locus tag: HCH_01095 Name: allC Funciton: Allantoicase (EC 3.5.3.4) Locus tag: HCH_01094 Name: pucL Funciton: Uricase (EC 1.7.3.3) Locus tag: HCH_01093 Name: pucM Funciton: Hydroxyisourate hydrolase (EC 3.5.2.17) Locus tag: HCH_01092 Name: allA Funciton: Ureidoglycolate hydrolase (EC 3.5.3.19) Locus tag: HCH_01091 Name: guaD Funciton: Guanine deaminase (EC 3.5.4.3) Locus tag: HCH_01090 Name: COG3748 Funciton: Predicted inner membrane protein
xdhA-xdhB-xdhC-allB-allC-pucL-pucM-allA-guaD-COG3748	-157	5.2	ACCTGACCATGTAGACAAGT	HCH_01099
Reinekea sp. MED297
Position: -147 Score: 5.86323 Sequence: ACCTGACCGCATGGTCAGCT Locus tag: MED297_08316 Name: xdhA Funciton: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4) Locus tag: MED297_08321 Name: xdhB Funciton: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4) Locus tag: MED297_08326 Name: xdhC Funciton: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase) Locus tag: MED297_08331 Name: allB Funciton: Allantoinase (EC 3.5.2.5) Locus tag: MED297_08336 Name: pucL Funciton: Uricase (EC 1.7.3.3) Locus tag: MED297_08341 Name: pucM Funciton: Hydroxyisourate hydrolase (EC 3.5.2.17) Locus tag: MED297_08346 Name: COG3748 Funciton: Predicted inner membrane protein
xdhA-xdhB-xdhC-allB-pucL-pucM-COG3748	-147	5.9	ACCTGACCGCATGGTCAGCT	MED297_08316