Regulon of RutR in Reinekea sp. MED297

Properties
Regulator type:	Transcription factor
TF locus tag:	MED297_01515
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Pyrimidine utilization
Effector:	Uracil
Regulog:	RutR - Oceanospirillales/Alteromonadales
Statistics of regulated genes:
- Genes	11
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 32 sites [see more]

Member of regulog collections

By trascription factor - RutR
By taxonomy - Oceanospirillales/Alteromonadales
By TF family - TetR
By effector - Uracil
By pathway - Pyrimidine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -2 Score: 4.3 Sequence: TCATGACTGCTCAGACAGAT Locus tag: MED297_21307 Name: ppuA Funciton: Predicted ABC transporter, ATP-binding protein Locus tag: MED297_21302 Name: ppuC Funciton: Predicted ABC transporter, permease protein Locus tag: MED297_21297 Name: ppuD Funciton: Predicted ABC transporter, inner membrane protein precursor
	MED297_21307	ppuA	Predicted ABC transporter, ATP-binding protein
	MED297_21302	ppuC	Predicted ABC transporter, permease protein
	MED297_21297	ppuD	Predicted ABC transporter, inner membrane protein precursor
Position: -147 Score: 5.9 Sequence: ACCTGACCGCATGGTCAGCT Locus tag: MED297_08316 Name: xdhA Funciton: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4) Locus tag: MED297_08321 Name: xdhB Funciton: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4) Locus tag: MED297_08326 Name: xdhC Funciton: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase) Locus tag: MED297_08331 Name: allB Funciton: Allantoinase (EC 3.5.2.5) Locus tag: MED297_08336 Name: pucL Funciton: Uricase (EC 1.7.3.3) Locus tag: MED297_08341 Name: pucM Funciton: Hydroxyisourate hydrolase (EC 3.5.2.17) Locus tag: MED297_08346 Name: COG3748 Funciton: Predicted inner membrane protein
	MED297_08316	xdhA	Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4)
	MED297_08321	xdhB	Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4)
	MED297_08326	xdhC	XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase)
	MED297_08331	allB	Allantoinase (EC 3.5.2.5)
	MED297_08336	pucL	Uricase (EC 1.7.3.3)
	MED297_08341	pucM	Hydroxyisourate hydrolase (EC 3.5.2.17)
	MED297_08346	COG3748	Predicted inner membrane protein
Position: -156 Score: 4.3 Sequence: TGTTGACCATGTGGTTAGGA Locus tag: MED297_06818 Name: guaD Funciton: Guanine deaminase (EC 3.5.4.3)
	MED297_06818	guaD	Guanine deaminase (EC 3.5.4.3)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD