Regulon of RutR in Marinomonas sp. MWYL1

Properties
Regulator type:	Transcription factor
TF locus tag:	Mmwyl1_1423
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Pyrimidine utilization
Effector:	Uracil
Regulog:	RutR - Oceanospirillales/Alteromonadales
Statistics of regulated genes:
- Genes	14
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 32 sites [see more]

Member of regulog collections

By trascription factor - RutR
By taxonomy - Oceanospirillales/Alteromonadales
By TF family - TetR
By effector - Uracil
By pathway - Pyrimidine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -62 Score: 4 Sequence: GTATAACCATTCGGTCAAAC Locus tag: Mmwyl1_1677 Name: guaD Funciton: Guanine deaminase (EC 3.5.4.3)
	Mmwyl1_1677	guaD	Guanine deaminase (EC 3.5.4.3)
Position: -83 Score: 5 Sequence: ATTTGTACGATTGGTCAGGT Locus tag: Mmwyl1_2699 Name: xdhA Funciton: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4) Locus tag: Mmwyl1_2698 Name: xdhB Funciton: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4) Locus tag: Mmwyl1_2697 Name: xdhC Funciton: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase)
	Mmwyl1_2699	xdhA	Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4)
	Mmwyl1_2698	xdhB	Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4)
	Mmwyl1_2697	xdhC	XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase)
Position: -64 Score: 4.1 Sequence: TTTTGACCAGTTAGGCAGGG Locus tag: Mmwyl1_0632 Name: ppuB Funciton: Predicted ABC transporter, substrate-binding protein precursor Locus tag: Mmwyl1_0633 Name: ppuA Funciton: Predicted ABC transporter, ATP-binding protein Locus tag: Mmwyl1_0634 Name: ppuC Funciton: Predicted ABC transporter, permease protein Locus tag: Mmwyl1_0635 Name: ppuD Funciton: Predicted ABC transporter, inner membrane protein precursor
	Mmwyl1_0632	ppuB	Predicted ABC transporter, substrate-binding protein precursor
	Mmwyl1_0633	ppuA	Predicted ABC transporter, ATP-binding protein
	Mmwyl1_0634	ppuC	Predicted ABC transporter, permease protein
	Mmwyl1_0635	ppuD	Predicted ABC transporter, inner membrane protein precursor
Position: -117 Score: 4.9 Sequence: TACTGACCAAATGATCAGTT Locus tag: Mmwyl1_1566 Name: pbuT Funciton: Xanthine/uracil permease
	Mmwyl1_1566	pbuT	Xanthine/uracil permease
Position: -185 Score: 4.5 Sequence: TATTAACTAGTCGGTCAGAT Locus tag: Mmwyl1_1926 Name: ppuA Funciton: Predicted ABC transporter, ATP-binding protein Locus tag: Mmwyl1_1925 Name: ppuC Funciton: Predicted ABC transporter, permease protein Locus tag: Mmwyl1_1924 Name: ppuD Funciton: Predicted ABC transporter, inner membrane protein precursor Locus tag: Mmwyl1_1923 Name: ppuB Funciton: Predicted ABC transporter, substrate-binding protein precursor Locus tag: Mmwyl1_1922 Name: add Funciton: Adenosine deaminase (EC 3.5.4.4)
	Mmwyl1_1926	ppuA	Predicted ABC transporter, ATP-binding protein
	Mmwyl1_1925	ppuC	Predicted ABC transporter, permease protein
	Mmwyl1_1924	ppuD	Predicted ABC transporter, inner membrane protein precursor
	Mmwyl1_1923	ppuB	Predicted ABC transporter, substrate-binding protein precursor
	Mmwyl1_1922	add	Adenosine deaminase (EC 3.5.4.4)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD