Regulon of RutR in Cellvibrio japonicus Ueda107

Properties
Regulator type:	Transcription factor
TF locus tag:	CJA_0541
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Pyrimidine utilization
Effector:	Uracil
Regulog:	RutR - Oceanospirillales/Alteromonadales
Statistics of regulated genes:
- Genes	14
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 32 sites [see more]

Member of regulog collections

By trascription factor - RutR
By taxonomy - Oceanospirillales/Alteromonadales
By TF family - TetR
By effector - Uracil
By pathway - Pyrimidine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -201 Score: 4.8 Sequence: ACCTGACTGCACGGACAAAA Position: -77 Score: 4.2 Sequence: AATTGTCTATTTGGCCAGTC Locus tag: CJA_0546 Name: xdhA Funciton: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4) Locus tag: CJA_0547 Name: xdhB Funciton: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4) Locus tag: CJA_0548 Name: xdhC Funciton: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase) Locus tag: CJA_0549 Name: pucL Funciton: Uricase (EC 1.7.3.3) Locus tag: CJA_0550 Name: pucM Funciton: Hydroxyisourate hydrolase (EC 3.5.2.17) Locus tag: CJA_0551 Name: guaD Funciton: Guanine deaminase (EC 3.5.4.3) Locus tag: CJA_0552 Name: COG3748 Funciton: Predicted inner membrane protein
	CJA_0546	xdhA	Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4)
	CJA_0547	xdhB	Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4)
	CJA_0548	xdhC	XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase)
	CJA_0549	pucL	Uricase (EC 1.7.3.3)
	CJA_0550	pucM	Hydroxyisourate hydrolase (EC 3.5.2.17)
	CJA_0551	guaD	Guanine deaminase (EC 3.5.4.3)
	CJA_0552	COG3748	Predicted inner membrane protein
Position: -165 Score: 4.5 Sequence: GACTGGCCAAATAGACAATT Position: -41 Score: 4.4 Sequence: TTTTGTCCGTGCAGTCAGGT Locus tag: CJA_0545 Name: ppuA Funciton: Predicted ABC transporter, ATP-binding protein Locus tag: CJA_0544 Name: ppuC Funciton: Predicted ABC transporter, permease protein Locus tag: CJA_0543 Name: ppuD Funciton: Predicted ABC transporter, inner membrane protein precursor Locus tag: CJA_0542 Name: ppuB Funciton: Predicted ABC transporter, substrate-binding protein precursor Locus tag: CJA_0541 Name: rutR Funciton: Transcriptional regulator RutR of pyrimidine catabolism, TetR family Locus tag: CJA_0540 Name: ssnA Funciton: Predicted chlorohydrolase/aminohydrolase
	CJA_0545	ppuA	Predicted ABC transporter, ATP-binding protein
	CJA_0544	ppuC	Predicted ABC transporter, permease protein
	CJA_0543	ppuD	Predicted ABC transporter, inner membrane protein precursor
	CJA_0542	ppuB	Predicted ABC transporter, substrate-binding protein precursor
	CJA_0541	rutR	Transcriptional regulator RutR of pyrimidine catabolism, TetR family
	CJA_0540	ssnA	Predicted chlorohydrolase/aminohydrolase
Position: -70 Score: 4.4 Sequence: ATCCATCCAAATGGTCAATT Locus tag: CJA_0583 Name: nupP Funciton: Predicted purine nucleoside permease
	CJA_0583	nupP	Predicted purine nucleoside permease

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD