Regulog LexA - Alteromonadales
| Regulator type: | Transcription factor |
| Regulator family: | LexA |
| Regulation mode: | repressor |
| Biological process: | SOS response |
| Effector: | DNA damage |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Alteromonadales
- By trascription factor - LexA
- By TF family - LexA
- By effector - DNA damage
- By pathway - SOS response
| Genome | Genes | Operons |
|---|---|---|
| Pseudoalteromonas atlantica T6c | 13 | 11 |
| Alteromonas macleodii 'Deep ecotype' | 10 | 10 |
| Glaciecola sp. HTCC2999 | 11 | 9 |
| Colwellia psychrerythraea 34H | 15 | 12 |
| Alteromonadales bacterium TW-7 | 12 | 11 |
| Pseudoalteromonas haloplanktis TAC125 | 15 | 12 |
| Pseudoalteromonas tunicata D2 | 14 | 11 |
| Idiomarina baltica OS145 | 7 | 5 |
| Idiomarina loihiensis L2TR | 8 | 6 |
| Genes | Function | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||
| ruvC |
Gene: Patl_2946: Crossover junction endodeoxyribonuclease RuvC (EC 3.1.22.4) |
*
Alteromonas macleodii 'Deep ecotype' Site: position = 7 score = 4.71063 sequence = TACTGGGTATAGATCCAGGT Gene: MADE_01729: Crossover junction endodeoxyribonuclease RuvC (EC 3.1.22.4) |
Gene: GHTCC_010100005784: Crossover junction endodeoxyribonuclease RuvC (EC 3.1.22.4) |
*
Colwellia psychrerythraea 34H Site: position = -115 score = 4.33899 sequence = TACTGTATATCAGTAATGTT Gene: CPS_2115: Crossover junction endodeoxyribonuclease RuvC (EC 3.1.22.4) |
Gene: ATW7_08572: Crossover junction endodeoxyribonuclease RuvC (EC 3.1.22.4) |
*
Pseudoalteromonas haloplanktis TAC125 Site: position = -69 score = 5.29907 sequence = TACTGGTAATTTATACAGTG Gene: PSHAa1877: Crossover junction endodeoxyribonuclease RuvC (EC 3.1.22.4) |
*
Pseudoalteromonas tunicata D2 Site: position = -66 score = 5.17278 sequence = CACTGGTAATTTATACAGTT Gene: PTD2_22617: Crossover junction endodeoxyribonuclease RuvC (EC 3.1.22.4) |
Gene: OS145_11312: Crossover junction endodeoxyribonuclease RuvC (EC 3.1.22.4) |
Gene: IL1087: Crossover junction endodeoxyribonuclease RuvC (EC 3.1.22.4) |
Crossover junction endodeoxyribonuclease RuvC (EC 3.1.22.4) |
| ruvA |
Gene: Patl_2945: Holliday junction DNA helicase RuvA |
Gene: MADE_02691: Holliday junction DNA helicase RuvA |
*
Glaciecola sp. HTCC2999 Site: position = -69 score = 5.26631 sequence = ACTTGTATATATGTACAGTA Site: position = -56 score = 4.57203 sequence = TACAGTATTTTAGTACACTA Gene: GHTCC_010100005779: Holliday junction DNA helicase RuvA |
*
Colwellia psychrerythraea 34H Site: position = -60 score = 5.67545 sequence = TACTGTATAAATATATAGTG Gene: CPS_2116: Holliday junction DNA helicase RuvA |
Gene: ATW7_08567: Holliday junction DNA helicase RuvA |
Gene: PSHAa1876: Holliday junction DNA helicase RuvA |
Gene: PTD2_22612: Holliday junction DNA helicase RuvA |
Gene: OS145_11317: Holliday junction DNA helicase RuvA |
Gene: IL1086: Holliday junction DNA helicase RuvA |
Holliday junction DNA helicase RuvA |
| ruvB |
*
Pseudoalteromonas atlantica T6c Site: position = -40 score = 5.43435 sequence = CACTGTATATAAAACCACTA Gene: Patl_2944: Holliday junction DNA helicase RuvB |
Gene: MADE_02690: Holliday junction DNA helicase RuvB |
Gene: GHTCC_010100005774: Holliday junction DNA helicase RuvB |
Gene: CPS_2117: Holliday junction DNA helicase RuvB |
Gene: ATW7_08562: Holliday junction DNA helicase RuvB |
Gene: PSHAa1875: Holliday junction DNA helicase RuvB |
Gene: PTD2_22607: Holliday junction DNA helicase RuvB |
Gene: OS145_11322: Holliday junction DNA helicase RuvB |
Gene: IL1085: Holliday junction DNA helicase RuvB |
Holliday junction DNA helicase RuvB |
| CRON 2. | ||||||||||
| dinB |
*
Pseudoalteromonas atlantica T6c Site: position = -29 score = 5.75735 sequence = AACTGTTTTTAAATACAGTT Gene: Patl_0460: DNA polymerase IV (EC 2.7.7.7) |
*
Alteromonas macleodii 'Deep ecotype' Site: position = -76 score = 5.28467 sequence = TACTGTCTTTTTGTACAGTT Gene: MADE_00753: DNA polymerase IV (EC 2.7.7.7) |
*
Glaciecola sp. HTCC2999 Site: position = -34 score = 5.68134 sequence = TACTGGATTAATAAACAGTG Gene: GHTCC_010100007177: DNA polymerase IV (EC 2.7.7.7) |
*
Colwellia psychrerythraea 34H Site: position = -38 score = 6.02703 sequence = TACTGTTTTTATATACAGTT Gene: CPS_1040: DNA polymerase IV (EC 2.7.7.7) |
*2
Alteromonadales bacterium TW-7 Gene: ATW7_11110: DNA polymerase IV (EC 2.7.7.7) Site: position = -41 score = 5.1985 sequence = CACTGTATTTTTATACAGCC Gene: ATW7_11140: DNA polymerase IV (EC 2.7.7.7) |
*
Pseudoalteromonas haloplanktis TAC125 Site: position = -32 score = 5.65149 sequence = GGCTGTATAAATAAACAGTT Gene: PSHAa2389: DNA polymerase IV (EC 2.7.7.7) |
*
Pseudoalteromonas tunicata D2 Site: position = -52 score = 6.12203 sequence = TACTGTATAAAAAAACAGTG Gene: PTD2_12644: DNA polymerase IV (EC 2.7.7.7) |
Gene: OS145_02620: DNA polymerase IV (EC 2.7.7.7) |
Gene: IL0204: DNA polymerase IV (EC 2.7.7.7) |
DNA polymerase IV (EC 2.7.7.7) |
| CRON 3. | ||||||||||
| yebG |
*
Pseudoalteromonas atlantica T6c Site: position = -63 score = 5.62403 sequence = AACTGTACATAAAAACAGGT Gene: Patl_1244: SOS regulon DNA damage-inducible protein |
*
Alteromonas macleodii 'Deep ecotype' Site: position = -65 score = 6.07086 sequence = TACTGTTTATTTATACAGTT Gene: MADE_03780: SOS regulon DNA damage-inducible protein |
*
Glaciecola sp. HTCC2999 Site: position = -73 score = 5.64326 sequence = TACTGTTAATTTATACAGTG Site: position = -120 score = 6.21831 sequence = AACTGTATTTATATACAGTA Gene: GHTCC_010100001654: SOS regulon DNA damage-inducible protein |
*
Colwellia psychrerythraea 34H Site: position = -127 score = 5.41491 sequence = AACTGTTTTTATATACAGCT Gene: CPS_4298: SOS regulon DNA damage-inducible protein |
*
Alteromonadales bacterium TW-7 Site: position = -71 score = 6.42358 sequence = TACTGTATATAAAAACAGTA Gene: ATW7_09848: SOS regulon DNA damage-inducible protein |
*
Pseudoalteromonas haloplanktis TAC125 Site: position = -70 score = 6.12777 sequence = TACTGTACATAAAAACAGTA Gene: PSHAa0834: SOS regulon DNA damage-inducible protein |
*
Pseudoalteromonas tunicata D2 Site: position = -85 score = 6.25039 sequence = TACTGTATATAAAAACAGTG Gene: PTD2_15577: SOS regulon DNA damage-inducible protein |
|
*
Idiomarina loihiensis L2TR Site: position = -48 score = 6.13966 sequence = TACTGTACAAATAAACAGTA Gene: IL1548: SOS regulon DNA damage-inducible protein |
SOS regulon DNA damage-inducible protein |
| CRON 4. | ||||||||||
| lexA |
*
Pseudoalteromonas atlantica T6c Site: position = -25 score = 4.94887 sequence = AACTGTATGAAACAACAGGC Site: position = -46 score = 5.53076 sequence = GACTGTATATACTCACAGTT Gene: Patl_4247: SOS-response repressor and protease LexA (EC 3.4.21.88) |
*
Alteromonas macleodii 'Deep ecotype' Site: position = -44 score = 4.7777 sequence = AGGTGTATATACTTACAGGA Site: position = -25 score = 5.04261 sequence = AACTGTATGAACAGACAGGT Gene: MADE_04014: SOS-response repressor and protease LexA (EC 3.4.21.88) |
*
Glaciecola sp. HTCC2999 Site: position = -25 score = 5.33883 sequence = AACTGTATTAATTAACAGGC Site: position = -44 score = 5.82001 sequence = TACTGGATATACTAACAGTA Gene: GHTCC_010100008871: SOS-response repressor and protease LexA (EC 3.4.21.88) |
*
Colwellia psychrerythraea 34H Site: position = -27 score = 5.34003 sequence = TACTGTGTAAATTTACAGGC Site: position = -48 score = 5.45807 sequence = TCCTGTATATACTACCAGTA Gene: CPS_0237: SOS-response repressor and protease LexA (EC 3.4.21.88) |
*
Alteromonadales bacterium TW-7 Site: position = -47 score = 5.71644 sequence = AACTGTATATACTCACAGTT Site: position = -22 score = 5.47753 sequence = TACTGTATGGAAAACCAGTT Gene: ATW7_16997: SOS-response repressor and protease LexA (EC 3.4.21.88) |
*
Pseudoalteromonas haloplanktis TAC125 Site: position = -91 score = 5.47753 sequence = TACTGTATGGAAAACCAGTT Site: position = -116 score = 5.71644 sequence = AACTGTATATACTCACAGTT Gene: PSHAa2873: SOS-response repressor and protease LexA (EC 3.4.21.88) |
*
Pseudoalteromonas tunicata D2 Site: position = -45 score = 5.48981 sequence = AGCTGTATATAATCACAGTA Gene: PTD2_16946: SOS-response repressor and protease LexA (EC 3.4.21.88) |
*
Idiomarina baltica OS145 Site: position = -47 score = 5.392 sequence = ACCTGTATATACTCACAGTA Site: position = -27 score = 5.58593 sequence = TACTGTACAGATAAACAGGT Gene: OS145_02170: SOS-response repressor and protease LexA (EC 3.4.21.88) |
*
Idiomarina loihiensis L2TR Site: position = -46 score = 5.392 sequence = ACCTGTATATACTCACAGTA Site: position = -25 score = 5.5483 sequence = CACTGTACAAATAAACAGGT Gene: IL0262: SOS-response repressor and protease LexA (EC 3.4.21.88) |
SOS-response repressor and protease LexA (EC 3.4.21.88) |
| CRON 5. | ||||||||||
| Patl_2012 |
*
Pseudoalteromonas atlantica T6c Site: position = -28 score = 5.4523 sequence = CACTGTATAAACAAACAGGC Site: position = -64 score = 4.88806 sequence = GCATGTATTTTTATACAGTA Gene: Patl_2012: hypothetical protein |
*
Alteromonas macleodii 'Deep ecotype' Site: position = -64 score = 4.93407 sequence = CACTGTATAAGAAGCCAGTA Site: position = -81 score = 4.78787 sequence = TACTGTATACACATACACAC Gene: MADE_01066: hypothetical protein |
*
Glaciecola sp. HTCC2999 Site: position = -28 score = 5.15228 sequence = CACTGTATAAATAAACAAGG Site: position = -61 score = 5.83817 sequence = GACTGTTTATTTATACAGTA Gene: GHTCC_010100006337: hypothetical protein |
|
|
|
|
|
|
hypothetical protein |
| CRON 6. | ||||||||||
| dnaQ |
Gene: Patl_2348: DNA polymerase III epsilon subunit (EC 2.7.7.7) |
*
Alteromonas macleodii 'Deep ecotype' Site: position = -48 score = 5.28168 sequence = GGCTGTATAAATATACACTA Gene: MADE_03930: DNA polymerase III epsilon subunit (EC 2.7.7.7) |
|
|
*
Alteromonadales bacterium TW-7 Site: position = 8 score = 6.02703 sequence = TACTGTTTTTATATACAGTT Gene: ATW7_09096: DNA polymerase III epsilon subunit (EC 2.7.7.7) |
*
Pseudoalteromonas haloplanktis TAC125 Site: position = 8 score = 5.37017 sequence = TACTGTTTTTATATACAGCC Gene: PSHAa1996: DNA polymerase III epsilon subunit (EC 2.7.7.7) |
|
|
|
DNA polymerase III epsilon subunit (EC 2.7.7.7) |
| CRON 7. | ||||||||||
| ATW7_03087 |
|
|
|
|
*
Alteromonadales bacterium TW-7 Site: position = -49 score = 5.9019 sequence = TACTGTACATTTAAACAGTG Gene: ATW7_03087: Putative orphan protein |
*
Pseudoalteromonas haloplanktis TAC125 Site: position = -49 score = 6.2612 sequence = AACTGTATATATAAACAGTG Gene: PSHAb0389: Putative orphan protein |
*
Pseudoalteromonas tunicata D2 Site: position = -38 score = 6.03334 sequence = CACTGTATATAAAAACAGTG Gene: PTD2_02786: Putative orphan protein |
|
|
Putative orphan protein |
| CRON 8. | ||||||||||
| imuA |
*
Pseudoalteromonas atlantica T6c Site: position = -31 score = 4.0873 sequence = TACAGTAAAAATATACAACC Site: position = -44 score = 6.19957 sequence = TACTGTATGAATATACAGTA Gene: Patl_0036: Predicted RecA/RadA recombinase |
*
Alteromonas macleodii 'Deep ecotype' Site: position = -33 score = 6.23348 sequence = TACTGTATAAAAATACAGTT Gene: MADE_00040: Predicted RecA/RadA recombinase |
|
|
|
|
|
*
Idiomarina baltica OS145 Site: position = -36 score = 6.28869 sequence = TACTGTACATATATACAGTA Gene: OS145_09460: Predicted RecA/RadA recombinase |
*
Idiomarina loihiensis L2TR Site: position = -32 score = 6.30653 sequence = TACTGTATATATGTACAGTA Gene: IL2568: Predicted RecA/RadA recombinase |
Predicted RecA/RadA recombinase |
| imuB |
Gene: Patl_0035: DNA polymerase-like protein PA0670 |
Gene: MADE_00039: DNA polymerase-like protein PA0670 |
|
|
|
|
|
Gene: OS145_09455: DNA polymerase-like protein PA0670 |
Gene: IL2567: DNA polymerase-like protein PA0670 |
DNA polymerase-like protein PA0670 |
| dnaE2 |
|
Gene: MADE_00038: DNA polymerase III alpha subunit (EC 2.7.7.7) |
|
|
|
|
|
Gene: OS145_09450: DNA polymerase III alpha subunit (EC 2.7.7.7) |
Gene: IL2566: DNA polymerase III alpha subunit (EC 2.7.7.7) |
DNA polymerase III alpha subunit (EC 2.7.7.7) |
| CRON 9. | ||||||||||
| topB |
*
Pseudoalteromonas atlantica T6c Site: position = -43 score = 5.36375 sequence = TACTGTCTTTACATACAGTC Gene: Patl_0776: DNA topoisomerase III (EC 5.99.1.2) |
|
|
*
Colwellia psychrerythraea 34H Site: position = -71 score = 5.31261 sequence = AGCTGTACATAAAACCAGTA Gene: CPS_4792: DNA topoisomerase III (EC 5.99.1.2) |
*
Alteromonadales bacterium TW-7 Site: position = -32 score = 5.94383 sequence = TACTGTTTATATAACCAGTT Gene: ATW7_10960: DNA topoisomerase III (EC 5.99.1.2) |
*
Pseudoalteromonas haloplanktis TAC125 Site: position = -94 score = 4.07626 sequence = AACTAGAGATATATAAAGTT Gene: PSHAa2356: DNA topoisomerase III (EC 5.99.1.2) |
*
Pseudoalteromonas tunicata D2 Site: position = -33 score = 5.20643 sequence = CACTGTTAATCTATACAGTT Gene: PTD2_09304: DNA topoisomerase III (EC 5.99.1.2) |
|
|
DNA topoisomerase III (EC 5.99.1.2) |
| CRON 10. | ||||||||||
| umuD |
*
Pseudoalteromonas atlantica T6c Site: position = -21 score = 6.06842 sequence = TACTGTATATAATAACAGTG Gene: Patl_2345: DNA polymerase V, subunit UmuD |
|
*
Glaciecola sp. HTCC2999 Site: position = -54 score = 6.36183 sequence = TACTGTATATAAATACAGTT Site: position = -101 score = 6.03645 sequence = CACTGTATAAATTAACAGTA Gene: GHTCC_010100001659: DNA polymerase V, subunit UmuD |
*2
Colwellia psychrerythraea 34H Site: position = -35 score = 6.26228 sequence = TACTGTATATAATTACAGTA Gene: CPS_2683: DNA polymerase V, subunit UmuD Site: position = -35 score = 6.06978 sequence = TACTGTATTTATGTACAGTA Gene: CPS_1635: DNA polymerase V, subunit UmuD |
*
Alteromonadales bacterium TW-7 Site: position = -21 score = 5.76984 sequence = TACTGTACACTTATACAGTA Gene: ATW7_00530: DNA polymerase V, subunit UmuD |
*
Pseudoalteromonas haloplanktis TAC125 Site: position = -41 score = 5.78768 sequence = TACTGTATACTTGTACAGTA Gene: PSHAb0537: DNA polymerase V, subunit UmuD |
*
Pseudoalteromonas tunicata D2 Site: position = -21 score = 6.03238 sequence = TACTGTATATAACTACAGTA Gene: PTD2_17880: DNA polymerase V, subunit UmuD |
|
|
DNA polymerase V, subunit UmuD |
| umuC |
Gene: Patl_2344: DNA polymerase V, subunit UmuC |
|
Gene: GHTCC_010100001664: DNA polymerase V, subunit UmuC |
2
Colwellia psychrerythraea 34H Gene: CPS_2682: DNA polymerase V, subunit UmuC Gene: CPS_1636: DNA polymerase V, subunit UmuC |
Gene: ATW7_00525: DNA polymerase V, subunit UmuC |
Gene: PSHAb0536: DNA polymerase V, subunit UmuC |
Gene: PTD2_17875: DNA polymerase V, subunit UmuC |
|
|
DNA polymerase V, subunit UmuC |
| CRON 11. | ||||||||||
| SSF52540 |
|
|
|
*
Colwellia psychrerythraea 34H Site: position = -55 score = 5.83919 sequence = TACTGTACGTTTATACAGTA Gene: CPS_3201: hypothetical protein, P-loop containing nucleoside triphosphate hydrolase family |
*
Alteromonadales bacterium TW-7 Site: position = -31 score = 5.7152 sequence = TACTGTATATAAACCCAGTG Site: position = -44 score = 5.4293 sequence = TACTGTATACATGTACTGTA Gene: ATW7_06613: hypothetical protein, P-loop containing nucleoside triphosphate hydrolase family |
*
Pseudoalteromonas haloplanktis TAC125 Site: position = -32 score = 5.58684 sequence = TACTGTATAAAAACCCAGTG Site: position = -45 score = 4.85487 sequence = TACTGTATATGGGTACTGTA Gene: PSHAa1159: hypothetical protein, P-loop containing nucleoside triphosphate hydrolase family |
*
Pseudoalteromonas tunicata D2 Site: position = -28 score = 5.70149 sequence = CACTGTATAAACAACCAGTA Gene: PTD2_18455: hypothetical protein, P-loop containing nucleoside triphosphate hydrolase family |
|
|
hypothetical protein, P-loop containing nucleoside triphosphate hydrolase family |
| CRON 12. | ||||||||||
| recA |
*
Pseudoalteromonas atlantica T6c Site: position = -106 score = 5.41982 sequence = AACTGTATGGTTGTACAGTA Gene: Patl_3259: Recombinase A |
*
Alteromonas macleodii 'Deep ecotype' Site: position = -107 score = 5.40167 sequence = AACTGTATGCTTGTACAGTA Gene: MADE_03079: Recombinase A |
*
Glaciecola sp. HTCC2999 Site: position = -75 score = 6.04617 sequence = CACTGTATAATTATACAGTA Gene: GHTCC_010100000340: Recombinase A |
*
Colwellia psychrerythraea 34H Site: position = -68 score = 5.50414 sequence = TACTGTACGAACTTACAGTA Gene: CPS_4134: Recombinase A |
*
Alteromonadales bacterium TW-7 Site: position = -54 score = 4.98107 sequence = TACTGTGGTTTCATACAGTA Gene: ATW7_04497: Recombinase A |
*
Pseudoalteromonas haloplanktis TAC125 Site: position = -53 score = 5.21467 sequence = TACTGTGATTTCATACAGTA Gene: PSHAa0694: Recombinase A |
*
Pseudoalteromonas tunicata D2 Site: position = -55 score = 5.5059 sequence = TACTGTTAATCTATACAGTA Gene: PTD2_13014: Recombinase A |
*
Idiomarina baltica OS145 Site: position = -57 score = 5.66907 sequence = TACTGTGAATTTATACAGTA Gene: OS145_07237: Recombinase A |
*
Idiomarina loihiensis L2TR Site: position = -59 score = 5.53977 sequence = TACTGTAAATGTGTACAGTA Site: position = -39 score = 5.71282 sequence = TACTGTTTATAAAACCAGTG Gene: IL0742: Recombinase A |
Recombinase A |
| CRON 13. | ||||||||||
| uvrD |
*
Pseudoalteromonas atlantica T6c Site: position = -64 score = 5.42594 sequence = AATTGTATAAAAACACAGTA Gene: Patl_4079: ATP-dependent DNA helicase II |
*
Alteromonas macleodii 'Deep ecotype' Site: position = -79 score = 5.38991 sequence = GACTGTATAAATTAACAGGC Gene: MADE_00200: ATP-dependent DNA helicase II |
*
Glaciecola sp. HTCC2999 Site: position = -70 score = 5.85249 sequence = CACTGTATATATCAACAGTT Gene: GHTCC_010100004134: ATP-dependent DNA helicase II |
*
Colwellia psychrerythraea 34H Site: position = -130 score = 5.86188 sequence = TACTGTAATAATAAACAGTA Gene: CPS_0080: ATP-dependent DNA helicase II |
*
Alteromonadales bacterium TW-7 Site: position = -84 score = 5.37359 sequence = AGCTGTTCATAAAAACAGTA Gene: ATW7_15466: ATP-dependent DNA helicase II |
*
Pseudoalteromonas haloplanktis TAC125 Site: position = -84 score = 5.52203 sequence = AGCTGTGTATAAAAACAGTA Gene: PSHAa0122: ATP-dependent DNA helicase II |
*
Pseudoalteromonas tunicata D2 Site: position = -84 score = 5.35318 sequence = ACCTGTTCATAAAAACAGTA Gene: PTD2_09564: ATP-dependent DNA helicase II |
*
Idiomarina baltica OS145 Site: position = -66 score = 5.09716 sequence = AACTGGTTGCTTATACAGTA Gene: OS145_09368: ATP-dependent DNA helicase II |
*
Idiomarina loihiensis L2TR Site: position = -83 score = 5.0534 sequence = TACTGGTTGCTTATACAGTG Gene: IL2551: ATP-dependent DNA helicase II |
ATP-dependent DNA helicase II |
| CRON 14. | ||||||||||
| recN |
*
Pseudoalteromonas atlantica T6c Site: position = -26 score = 5.71862 sequence = TACTGTATATTTGAACAGGT Site: position = -45 score = 5.06031 sequence = ATATGTATATATTTACAGTT Gene: Patl_1714: DNA repair protein RecN |
*
Alteromonas macleodii 'Deep ecotype' Site: position = -41 score = 4.50844 sequence = TACTGTATATATCATCATGT Site: position = -60 score = 5.71387 sequence = TACTGTATATATTATCAGTT Gene: MADE_02270: DNA repair protein RecN |
*
Glaciecola sp. HTCC2999 Site: position = -28 score = 5.45787 sequence = TATTGTATATTTACACAGTG Site: position = -47 score = 5.32364 sequence = TACTGTATATATTTACACAT Gene: GHTCC_010100008506: DNA repair protein RecN |
*
Colwellia psychrerythraea 34H Site: position = -58 score = 6.17108 sequence = TACTGTATAAATTAACAGTT Gene: CPS_3825: DNA repair protein RecN |
*
Alteromonadales bacterium TW-7 Site: position = -43 score = 5.65475 sequence = CACTGTATAAATTACCAGTT Site: position = -19 score = 5.52585 sequence = AACTGGATGGATAAACAGTA Gene: ATW7_06923: DNA repair protein RecN |
*
Pseudoalteromonas haloplanktis TAC125 Site: position = -43 score = 5.95403 sequence = CACTGTATAAATTAACAGTT Site: position = -19 score = 5.34017 sequence = GACTGGATGGATAAACAGTA Gene: PSHAa1218: DNA repair protein RecN |
*
Pseudoalteromonas tunicata D2 Site: position = -43 score = 6.17108 sequence = TACTGTATAAATTAACAGTT Site: position = -19 score = 5.52585 sequence = AACTGGATGGATAAACAGTA Gene: PTD2_10739: DNA repair protein RecN |
*
Idiomarina baltica OS145 Site: position = -52 score = 5.82612 sequence = TACTGTATAGGTAAACAGTA Gene: OS145_12305: DNA repair protein RecN |
*
Idiomarina loihiensis L2TR Site: position = -34 score = 5.61566 sequence = ACCTGTATATATCAACAGTA Gene: IL0989: DNA repair protein RecN |
DNA repair protein RecN |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |