Regulon of LexA in Alteromonas macleodii 'Deep ecotype'

Properties
Regulator type:	Transcription factor
TF locus tag:	MADE_04014
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Alteromonadales
Statistics of regulated genes:
- Genes	10
- Operons	10
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 111 sites [see more]

Member of regulog collections

By taxonomy - Alteromonadales
By trascription factor - LexA
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -65 Score: 6.1 Sequence: TACTGTTTATTTATACAGTT Locus tag: MADE_03780 Name: yebG Funciton: SOS regulon DNA damage-inducible protein
	MADE_03780	yebG	SOS regulon DNA damage-inducible protein
Position: 7 Score: 4.7 Sequence: TACTGGGTATAGATCCAGGT Locus tag: MADE_01729 Name: ruvC Funciton: Crossover junction endodeoxyribonuclease RuvC (EC 3.1.22.4)
	MADE_01729	ruvC	Crossover junction endodeoxyribonuclease RuvC (EC 3.1.22.4)
Position: -60 Score: 5.7 Sequence: TACTGTATATATTATCAGTT Position: -41 Score: 4.5 Sequence: TACTGTATATATCATCATGT Locus tag: MADE_02270 Name: recN Funciton: DNA repair protein RecN
	MADE_02270	recN	DNA repair protein RecN
Position: -76 Score: 5.3 Sequence: TACTGTCTTTTTGTACAGTT Locus tag: MADE_00753 Name: dinB Funciton: DNA polymerase IV (EC 2.7.7.7)
	MADE_00753	dinB	DNA polymerase IV (EC 2.7.7.7)
Position: -81 Score: 4.8 Sequence: TACTGTATACACATACACAC Position: -64 Score: 4.9 Sequence: CACTGTATAAGAAGCCAGTA Locus tag: MADE_01066 Name: Patl_2012 Funciton: hypothetical protein
	MADE_01066	Patl_2012	hypothetical protein
Position: -48 Score: 5.3 Sequence: GGCTGTATAAATATACACTA Locus tag: MADE_03930 Name: dnaQ Funciton: DNA polymerase III epsilon subunit (EC 2.7.7.7)
	MADE_03930	dnaQ	DNA polymerase III epsilon subunit (EC 2.7.7.7)
Position: -79 Score: 5.4 Sequence: GACTGTATAAATTAACAGGC Locus tag: MADE_00200 Name: uvrD Funciton: ATP-dependent DNA helicase II
	MADE_00200	uvrD	ATP-dependent DNA helicase II
Position: -33 Score: 6.2 Sequence: TACTGTATAAAAATACAGTT Locus tag: MADE_00040 Name: imuA Funciton: Predicted RecA/RadA recombinase
	MADE_00040	imuA	Predicted RecA/RadA recombinase
Position: -44 Score: 4.8 Sequence: AGGTGTATATACTTACAGGA Position: -25 Score: 5 Sequence: AACTGTATGAACAGACAGGT Locus tag: MADE_04014 Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88)
	MADE_04014	lexA	SOS-response repressor and protease LexA (EC 3.4.21.88)
Position: -107 Score: 5.4 Sequence: AACTGTATGCTTGTACAGTA Locus tag: MADE_03079 Name: recA Funciton: Recombinase A
	MADE_03079	recA	Recombinase A

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of LexA in Alteromonas macleodii 'Deep ecotype'

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --