Regulon of LexA in Glaciecola sp. HTCC2999

Properties
Regulator type:	Transcription factor
TF locus tag:	GHTCC_010100008871
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Alteromonadales
Statistics of regulated genes:
- Genes	11
- Operons	9
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 111 sites [see more]

Member of regulog collections

By taxonomy - Alteromonadales
By trascription factor - LexA
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -69 Score: 5.3 Sequence: ACTTGTATATATGTACAGTA Position: -56 Score: 4.6 Sequence: TACAGTATTTTAGTACACTA Locus tag: GHTCC_010100005779 Name: ruvA Funciton: Holliday junction DNA helicase RuvA Locus tag: GHTCC_010100005774 Name: ruvB Funciton: Holliday junction DNA helicase RuvB
	GHTCC_010100005779	ruvA	Holliday junction DNA helicase RuvA
	GHTCC_010100005774	ruvB	Holliday junction DNA helicase RuvB
Position: -120 Score: 6.2 Sequence: AACTGTATTTATATACAGTA Position: -73 Score: 5.6 Sequence: TACTGTTAATTTATACAGTG Locus tag: GHTCC_010100001654 Name: yebG Funciton: SOS regulon DNA damage-inducible protein
	GHTCC_010100001654	yebG	SOS regulon DNA damage-inducible protein
Position: -34 Score: 5.7 Sequence: TACTGGATTAATAAACAGTG Locus tag: GHTCC_010100007177 Name: dinB Funciton: DNA polymerase IV (EC 2.7.7.7)
	GHTCC_010100007177	dinB	DNA polymerase IV (EC 2.7.7.7)
Position: -61 Score: 5.8 Sequence: GACTGTTTATTTATACAGTA Position: -28 Score: 5.2 Sequence: CACTGTATAAATAAACAAGG Locus tag: GHTCC_010100006337 Name: Patl_2012 Funciton: hypothetical protein
	GHTCC_010100006337	Patl_2012	hypothetical protein
Position: -47 Score: 5.3 Sequence: TACTGTATATATTTACACAT Position: -28 Score: 5.5 Sequence: TATTGTATATTTACACAGTG Locus tag: GHTCC_010100008506 Name: recN Funciton: DNA repair protein RecN
	GHTCC_010100008506	recN	DNA repair protein RecN
Position: -44 Score: 5.8 Sequence: TACTGGATATACTAACAGTA Position: -25 Score: 5.3 Sequence: AACTGTATTAATTAACAGGC Locus tag: GHTCC_010100008871 Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88)
	GHTCC_010100008871	lexA	SOS-response repressor and protease LexA (EC 3.4.21.88)
Position: -101 Score: 6 Sequence: CACTGTATAAATTAACAGTA Position: -54 Score: 6.4 Sequence: TACTGTATATAAATACAGTT Locus tag: GHTCC_010100001659 Name: umuD Funciton: DNA polymerase V, subunit UmuD Locus tag: GHTCC_010100001664 Name: umuC Funciton: DNA polymerase V, subunit UmuC
	GHTCC_010100001659	umuD	DNA polymerase V, subunit UmuD
	GHTCC_010100001664	umuC	DNA polymerase V, subunit UmuC
Position: -70 Score: 5.9 Sequence: CACTGTATATATCAACAGTT Locus tag: GHTCC_010100004134 Name: uvrD Funciton: ATP-dependent DNA helicase II
	GHTCC_010100004134	uvrD	ATP-dependent DNA helicase II
Position: -75 Score: 6 Sequence: CACTGTATAATTATACAGTA Locus tag: GHTCC_010100000340 Name: recA Funciton: Recombinase A
	GHTCC_010100000340	recA	Recombinase A

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of LexA in Glaciecola sp. HTCC2999

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --