Regulon of LexA in Pseudoalteromonas atlantica T6c

Properties
Regulator type:	Transcription factor
TF locus tag:	Patl_4247
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Alteromonadales
Statistics of regulated genes:
- Genes	13
- Operons	11
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 111 sites [see more]

Member of regulog collections

By taxonomy - Alteromonadales
By trascription factor - LexA
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -46 Score: 5.5 Sequence: GACTGTATATACTCACAGTT Position: -25 Score: 4.9 Sequence: AACTGTATGAAACAACAGGC Locus tag: Patl_4247 Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88)
	Patl_4247	lexA	SOS-response repressor and protease LexA (EC 3.4.21.88)
Position: -40 Score: 5.4 Sequence: CACTGTATATAAAACCACTA Locus tag: Patl_2944 Name: ruvB Funciton: Holliday junction DNA helicase RuvB
	Patl_2944	ruvB	Holliday junction DNA helicase RuvB
Position: -63 Score: 5.6 Sequence: AACTGTACATAAAAACAGGT Locus tag: Patl_1244 Name: yebG Funciton: SOS regulon DNA damage-inducible protein
	Patl_1244	yebG	SOS regulon DNA damage-inducible protein
Position: -44 Score: 6.2 Sequence: TACTGTATGAATATACAGTA Position: -31 Score: 4.1 Sequence: TACAGTAAAAATATACAACC Locus tag: Patl_0036 Name: imuA Funciton: Predicted RecA/RadA recombinase Locus tag: Patl_0035 Name: imuB Funciton: DNA polymerase-like protein PA0670
	Patl_0036	imuA	Predicted RecA/RadA recombinase
	Patl_0035	imuB	DNA polymerase-like protein PA0670
Position: -29 Score: 5.8 Sequence: AACTGTTTTTAAATACAGTT Locus tag: Patl_0460 Name: dinB Funciton: DNA polymerase IV (EC 2.7.7.7)
	Patl_0460	dinB	DNA polymerase IV (EC 2.7.7.7)
Position: -64 Score: 4.9 Sequence: GCATGTATTTTTATACAGTA Position: -28 Score: 5.5 Sequence: CACTGTATAAACAAACAGGC Locus tag: Patl_2012 Name: Patl_2012 Funciton: hypothetical protein
	Patl_2012	Patl_2012	hypothetical protein
Position: -45 Score: 5.1 Sequence: ATATGTATATATTTACAGTT Position: -26 Score: 5.7 Sequence: TACTGTATATTTGAACAGGT Locus tag: Patl_1714 Name: recN Funciton: DNA repair protein RecN
	Patl_1714	recN	DNA repair protein RecN
Position: -43 Score: 5.4 Sequence: TACTGTCTTTACATACAGTC Locus tag: Patl_0776 Name: topB Funciton: DNA topoisomerase III (EC 5.99.1.2)
	Patl_0776	topB	DNA topoisomerase III (EC 5.99.1.2)
Position: -64 Score: 5.4 Sequence: AATTGTATAAAAACACAGTA Locus tag: Patl_4079 Name: uvrD Funciton: ATP-dependent DNA helicase II
	Patl_4079	uvrD	ATP-dependent DNA helicase II
Position: -21 Score: 6.1 Sequence: TACTGTATATAATAACAGTG Locus tag: Patl_2345 Name: umuD Funciton: DNA polymerase V, subunit UmuD Locus tag: Patl_2344 Name: umuC Funciton: DNA polymerase V, subunit UmuC
	Patl_2345	umuD	DNA polymerase V, subunit UmuD
	Patl_2344	umuC	DNA polymerase V, subunit UmuC
Position: -106 Score: 5.4 Sequence: AACTGTATGGTTGTACAGTA Locus tag: Patl_3259 Name: recA Funciton: Recombinase A
	Patl_3259	recA	Recombinase A

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of LexA in Pseudoalteromonas atlantica T6c

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --