Regulon of LexA in Idiomarina loihiensis L2TR

Properties
Regulator type:	Transcription factor
TF locus tag:	IL0262
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Alteromonadales
Statistics of regulated genes:
- Genes	8
- Operons	6
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 111 sites [see more]

Member of regulog collections

By taxonomy - Alteromonadales
By trascription factor - LexA
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -83 Score: 5.1 Sequence: TACTGGTTGCTTATACAGTG Locus tag: IL2551 Name: uvrD Funciton: ATP-dependent DNA helicase II
	IL2551	uvrD	ATP-dependent DNA helicase II
Position: -32 Score: 6.3 Sequence: TACTGTATATATGTACAGTA Locus tag: IL2568 Name: imuA Funciton: Predicted RecA/RadA recombinase Locus tag: IL2567 Name: imuB Funciton: DNA polymerase-like protein PA0670 Locus tag: IL2566 Name: dnaE2 Funciton: DNA polymerase III alpha subunit (EC 2.7.7.7)
	IL2568	imuA	Predicted RecA/RadA recombinase
	IL2567	imuB	DNA polymerase-like protein PA0670
	IL2566	dnaE2	DNA polymerase III alpha subunit (EC 2.7.7.7)
Position: -59 Score: 5.5 Sequence: TACTGTAAATGTGTACAGTA Position: -39 Score: 5.7 Sequence: TACTGTTTATAAAACCAGTG Locus tag: IL0742 Name: recA Funciton: Recombinase A
	IL0742	recA	Recombinase A
Position: -46 Score: 5.4 Sequence: ACCTGTATATACTCACAGTA Position: -25 Score: 5.5 Sequence: CACTGTACAAATAAACAGGT Locus tag: IL0262 Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88)
	IL0262	lexA	SOS-response repressor and protease LexA (EC 3.4.21.88)
Position: -34 Score: 5.6 Sequence: ACCTGTATATATCAACAGTA Locus tag: IL0989 Name: recN Funciton: DNA repair protein RecN
	IL0989	recN	DNA repair protein RecN
Position: -48 Score: 6.1 Sequence: TACTGTACAAATAAACAGTA Locus tag: IL1548 Name: yebG Funciton: SOS regulon DNA damage-inducible protein
	IL1548	yebG	SOS regulon DNA damage-inducible protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD