Regulon of LexA in Alteromonadales bacterium TW-7

Properties
Regulator type:	Transcription factor
TF locus tag:	ATW7_16997
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Alteromonadales
Statistics of regulated genes:
- Genes	12
- Operons	11
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 111 sites [see more]

Member of regulog collections

By taxonomy - Alteromonadales
By trascription factor - LexA
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -44 Score: 5.4 Sequence: TACTGTATACATGTACTGTA Position: -31 Score: 5.7 Sequence: TACTGTATATAAACCCAGTG Locus tag: ATW7_06613 Name: SSF52540 Funciton: hypothetical protein, P-loop containing nucleoside triphosphate hydrolase family
	ATW7_06613	SSF52540	hypothetical protein, P-loop containing nucleoside triphosphate hydrolase family
Position: -21 Score: 5.8 Sequence: TACTGTACACTTATACAGTA Locus tag: ATW7_00530 Name: umuD Funciton: DNA polymerase V, subunit UmuD Locus tag: ATW7_00525 Name: umuC Funciton: DNA polymerase V, subunit UmuC
	ATW7_00530	umuD	DNA polymerase V, subunit UmuD
	ATW7_00525	umuC	DNA polymerase V, subunit UmuC
Position: -71 Score: 6.4 Sequence: TACTGTATATAAAAACAGTA Locus tag: ATW7_09848 Name: yebG Funciton: SOS regulon DNA damage-inducible protein
	ATW7_09848	yebG	SOS regulon DNA damage-inducible protein
Position: -84 Score: 5.4 Sequence: AGCTGTTCATAAAAACAGTA Locus tag: ATW7_15466 Name: uvrD Funciton: ATP-dependent DNA helicase II
	ATW7_15466	uvrD	ATP-dependent DNA helicase II
Position: -41 Score: 5.2 Sequence: CACTGTATTTTTATACAGCC Locus tag: ATW7_11140 Name: dinB Funciton: DNA polymerase IV (EC 2.7.7.7)
	ATW7_11140	dinB	DNA polymerase IV (EC 2.7.7.7)
Position: -49 Score: 5.9 Sequence: TACTGTACATTTAAACAGTG Locus tag: ATW7_03087 Name: ATW7_03087 Funciton: Putative orphan protein
	ATW7_03087	ATW7_03087	Putative orphan protein
Position: -32 Score: 5.9 Sequence: TACTGTTTATATAACCAGTT Locus tag: ATW7_10960 Name: topB Funciton: DNA topoisomerase III (EC 5.99.1.2)
	ATW7_10960	topB	DNA topoisomerase III (EC 5.99.1.2)
Position: 8 Score: 6 Sequence: TACTGTTTTTATATACAGTT Locus tag: ATW7_09096 Name: dnaQ Funciton: DNA polymerase III epsilon subunit (EC 2.7.7.7)
	ATW7_09096	dnaQ	DNA polymerase III epsilon subunit (EC 2.7.7.7)
Position: -47 Score: 5.7 Sequence: AACTGTATATACTCACAGTT Position: -22 Score: 5.5 Sequence: TACTGTATGGAAAACCAGTT Locus tag: ATW7_16997 Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88)
	ATW7_16997	lexA	SOS-response repressor and protease LexA (EC 3.4.21.88)
Position: -43 Score: 5.7 Sequence: CACTGTATAAATTACCAGTT Position: -19 Score: 5.5 Sequence: AACTGGATGGATAAACAGTA Locus tag: ATW7_06923 Name: recN Funciton: DNA repair protein RecN
	ATW7_06923	recN	DNA repair protein RecN
Position: -54 Score: 5 Sequence: TACTGTGGTTTCATACAGTA Locus tag: ATW7_04497 Name: recA Funciton: Recombinase A
	ATW7_04497	recA	Recombinase A

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of LexA in Alteromonadales bacterium TW-7

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --