Regulon of LexA in Idiomarina baltica OS145

Properties
Regulator type:	Transcription factor
TF locus tag:	OS145_02170
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Alteromonadales
Statistics of regulated genes:
- Genes	7
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 111 sites [see more]

Member of regulog collections

By taxonomy - Alteromonadales
By trascription factor - LexA
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -66 Score: 5.1 Sequence: AACTGGTTGCTTATACAGTA Locus tag: OS145_09368 Name: uvrD Funciton: ATP-dependent DNA helicase II
	OS145_09368	uvrD	ATP-dependent DNA helicase II
Position: -47 Score: 5.4 Sequence: ACCTGTATATACTCACAGTA Position: -27 Score: 5.6 Sequence: TACTGTACAGATAAACAGGT Locus tag: OS145_02170 Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88)
	OS145_02170	lexA	SOS-response repressor and protease LexA (EC 3.4.21.88)
Position: -36 Score: 6.3 Sequence: TACTGTACATATATACAGTA Locus tag: OS145_09460 Name: imuA Funciton: Predicted RecA/RadA recombinase Locus tag: OS145_09455 Name: imuB Funciton: DNA polymerase-like protein PA0670 Locus tag: OS145_09450 Name: dnaE2 Funciton: DNA polymerase III alpha subunit (EC 2.7.7.7)
	OS145_09460	imuA	Predicted RecA/RadA recombinase
	OS145_09455	imuB	DNA polymerase-like protein PA0670
	OS145_09450	dnaE2	DNA polymerase III alpha subunit (EC 2.7.7.7)
Position: -52 Score: 5.8 Sequence: TACTGTATAGGTAAACAGTA Locus tag: OS145_12305 Name: recN Funciton: DNA repair protein RecN
	OS145_12305	recN	DNA repair protein RecN
Position: -57 Score: 5.7 Sequence: TACTGTGAATTTATACAGTA Locus tag: OS145_07237 Name: recA Funciton: Recombinase A
	OS145_07237	recA	Recombinase A

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD