Regulog Zur - Oceanospirillales/Alteromonadales

Properties
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 51 sites [see more]

Member of regulog collections

By taxonomy - Oceanospirillales/Alteromonadales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Statistics of regulated genes
Genome	Genes	Operons
Hahella chejuensis KCTC 2396	16	7
Marinobacter aqueolei	2	2
Marinobacter sp. ELB17	5	4
Oceanobacter sp. RED65	1	1
Oceanospirillum sp. MED92	9	6
Marinomonas sp. MWYL1	7	4
Saccharophagus degradans 2-40	6	3
Teredinibacter turnerae T7901	6	3
Cellvibrio japonicus Ueda107	5	3
Chromohalobacter salexigens DSM 3043	6	4
Reinekea sp. MED297	7	3
Alcanivorax borkumensis SK2	12	2

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes													Function

CRON 1.
zbp	* Hahella chejuensis KCTC 2396 Site: position = -70 score = 5.71739 sequence = GTTTCGTTATGTTATAACATAAA Gene: HCH_00656: Predicted zinc-binding protein	* Marinobacter aqueolei Site: position = -39 score = 5.60099 sequence = AAAATGTTATAACATATCAAATA Gene: Maqu_3429: Predicted zinc-binding protein	* Marinobacter sp. ELB17 Site: position = -34 score = 5.86207 sequence = AAGATGTTATAACATAACTTTAC Gene: MELB17_02870: Predicted zinc-binding protein	Oceanobacter sp. RED65	* Oceanospirillum sp. MED92 Site: position = -28 score = 5.68266 sequence = TTGTTGTTATATTATAACTTTTA Gene: MED92_15318: Predicted zinc-binding protein	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40 Gene: Sde_1976: Predicted zinc-binding protein	Teredinibacter turnerae T7901 Gene: TERTU_2265: Predicted zinc-binding protein	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297	Alcanivorax borkumensis SK2 Gene: ABO_1675: Predicted zinc-binding protein	Predicted zinc-binding protein

CRON 2.
zinT	Hahella chejuensis KCTC 2396	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	* Chromohalobacter salexigens DSM 3043 Site: position = -70 score = 5.33914 sequence = AGAAAGATATGTTATAACGTATT Gene: Csal_0187: Candidate zinc-binding lipoprotein ZinT	Reinekea sp. MED297	Alcanivorax borkumensis SK2	Candidate zinc-binding lipoprotein ZinT

CRON 3.
HCH_02943	* Hahella chejuensis KCTC 2396 Site: position = -66 score = 4.93623 sequence = AAAAAGATATGATGCAACATATC Gene: HCH_02943: hypothetical protein	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297	Alcanivorax borkumensis SK2	hypothetical protein
omr	Hahella chejuensis KCTC 2396 Gene: HCH_02944: Zinc-regulated TonB-dependent outer membrane receptor	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297	Alcanivorax borkumensis SK2	Zinc-regulated TonB-dependent outer membrane receptor
znuA2	Hahella chejuensis KCTC 2396 Gene: HCH_02945: Zinc ABC transporter, periplasmic-binding protein ZnuA	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297	Alcanivorax borkumensis SK2	Zinc ABC transporter, periplasmic-binding protein ZnuA
znuB2	Hahella chejuensis KCTC 2396 Gene: HCH_02946: Zinc ABC transporter, inner membrane permease protein ZnuB	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297	Alcanivorax borkumensis SK2	Zinc ABC transporter, inner membrane permease protein ZnuB

CRON 4.
znuC	2 Hahella chejuensis KCTC 2396 Gene: HCH_00536: Zinc ABC transporter, ATP-binding protein ZnuC Gene: HCH_02940: Zinc ABC transporter, ATP-binding protein ZnuC	Marinobacter aqueolei Gene: Maqu_3776: Zinc ABC transporter, ATP-binding protein ZnuC	2 Marinobacter sp. ELB17* Site: position = -102 score = 5.5346 sequence = TGAACGTTATGTTATAACATTGC Gene: MELB17_12886: Zinc ABC transporter, ATP-binding protein ZnuC Gene: MELB17_01715: Zinc ABC transporter, ATP-binding protein ZnuC	Oceanobacter sp. RED65 Gene: RED65_08379: Zinc ABC transporter, ATP-binding protein ZnuC	Oceanospirillum sp. MED92 Gene: MED92_05838: Zinc ABC transporter, ATP-binding protein ZnuC	Marinomonas sp. MWYL1 Gene: Mmwyl1_0293: Zinc ABC transporter, ATP-binding protein ZnuC	Saccharophagus degradans 2-40 Gene: Sde_0058: Zinc ABC transporter, ATP-binding protein ZnuC	Teredinibacter turnerae T7901 Gene: TERTU_0052: Zinc ABC transporter, ATP-binding protein ZnuC	Cellvibrio japonicus Ueda107 Gene: CJA_3483: Zinc ABC transporter, ATP-binding protein ZnuC	* Chromohalobacter salexigens DSM 3043 Site: position = -56 score = 5.86682 sequence = AAAGAGTTATGTTATAACATATA Gene: Csal_0189: Zinc ABC transporter, ATP-binding protein ZnuC	* Reinekea sp. MED297 Site: position = -124 score = 5.38642 sequence = TAAATGATATGATGTATCATAAC Site: position = -119 score = 5.15138 sequence = GATATGATGTATCATAACAAATA Gene: MED297_11285: Zinc ABC transporter, ATP-binding protein ZnuC	Alcanivorax borkumensis SK2 Gene: ABO_0156: Zinc ABC transporter, ATP-binding protein ZnuC	Zinc ABC transporter, ATP-binding protein ZnuC
znuB	2 Hahella chejuensis KCTC 2396 Gene: HCH_00535: Zinc ABC transporter, inner membrane permease protein ZnuB Gene: HCH_02939: Zinc ABC transporter, inner membrane permease protein ZnuB	Marinobacter aqueolei Gene: Maqu_3777: Zinc ABC transporter, inner membrane permease protein ZnuB	2 Marinobacter sp. ELB17 Gene: MELB17_12881: Zinc ABC transporter, inner membrane permease protein ZnuB Gene: MELB17_01710: Zinc ABC transporter, inner membrane permease protein ZnuB	Oceanobacter sp. RED65 Gene: RED65_08384: Zinc ABC transporter, inner membrane permease protein ZnuB	Oceanospirillum sp. MED92 Gene: MED92_05833: Zinc ABC transporter, inner membrane permease protein ZnuB	Marinomonas sp. MWYL1 Gene: Mmwyl1_0294: Zinc ABC transporter, inner membrane permease protein ZnuB	Saccharophagus degradans 2-40 Gene: Sde_0057: Zinc ABC transporter, inner membrane permease protein ZnuB	Teredinibacter turnerae T7901 Gene: TERTU_0051: Zinc ABC transporter, inner membrane permease protein ZnuB	Cellvibrio japonicus Ueda107 Gene: CJA_3484: Zinc ABC transporter, inner membrane permease protein ZnuB	Chromohalobacter salexigens DSM 3043 Gene: Csal_0190: Zinc ABC transporter, inner membrane permease protein ZnuB	Reinekea sp. MED297 Gene: MED297_11290: Zinc ABC transporter, inner membrane permease protein ZnuB	Alcanivorax borkumensis SK2 Gene: ABO_0157: Zinc ABC transporter, inner membrane permease protein ZnuB	Zinc ABC transporter, inner membrane permease protein ZnuB
yciC	Hahella chejuensis KCTC 2396	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297 Gene: MED297_11295: Putative metal chaperone, GTPase of COG0523 family	Alcanivorax borkumensis SK2	Putative metal chaperone, GTPase of COG0523 family
PF08856	Hahella chejuensis KCTC 2396	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297 Gene: MED297_11300: hypothetical protein	Alcanivorax borkumensis SK2	hypothetical protein
zur	* Hahella chejuensis KCTC 2396 Site: position = -80 score = 5.34799 sequence = CAATTGTTATAACATTACACTTC Gene: HCH_00537: Zinc uptake regulation protein ZUR	Marinobacter aqueolei Gene: Maqu_3775: Zinc uptake regulation protein ZUR	Marinobacter sp. ELB17 Gene: MELB17_01720: Zinc uptake regulation protein ZUR	Oceanobacter sp. RED65	* Oceanospirillum sp. MED92 Site: position = -43 score = 5.60068 sequence = TTAAAGTTACAATATAACACAAA Gene: MED92_05843: Zinc uptake regulation protein ZUR	Marinomonas sp. MWYL1 Gene: Mmwyl1_0292: Zinc uptake regulation protein ZUR	* Saccharophagus degradans 2-40 Site: position = -51 score = 6.05745 sequence = AAAGTGTTATATGATAACATAAC Gene: Sde_0059: Zinc uptake regulation protein ZUR	* Teredinibacter turnerae T7901 Site: position = -51 score = 5.95491 sequence = TAAACGTTATATGATAACATAAC Gene: TERTU_0053: Zinc uptake regulation protein ZUR	* Cellvibrio japonicus Ueda107 Site: position = -53 score = 5.27147 sequence = GAAAGGTTATAGAGTAACATAAC Gene: CJA_3482: Zinc uptake regulation protein ZUR	Chromohalobacter salexigens DSM 3043 Gene: Csal_1882: Zinc uptake regulation protein ZUR	Reinekea sp. MED297 Gene: MED297_11305: Zinc uptake regulation protein ZUR	Alcanivorax borkumensis SK2	Zinc uptake regulation protein ZUR
Mmwyl1_0291	Hahella chejuensis KCTC 2396	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	* Marinomonas sp. MWYL1 Site: position = -51 score = 5.20792 sequence = TACTTGTTATATCATAACAAAAT Gene: Mmwyl1_0291: putative membrane protein	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297	Alcanivorax borkumensis SK2	putative membrane protein
zur2	Hahella chejuensis KCTC 2396	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65 Gene: RED65_11929: Zinc uptake regulation protein paralog	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40 Gene: Sde_1974: Zinc uptake regulation protein paralog	Teredinibacter turnerae T7901 Gene: TERTU_3389: Zinc uptake regulation protein paralog	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	* Reinekea sp. MED297 Site: position = -77 score = 5.85057 sequence = TTAATGATATATCATATCATTTA Gene: MED297_00400: Zinc uptake regulation protein paralog	Alcanivorax borkumensis SK2	Zinc uptake regulation protein paralog

CRON 5.
rpmE2	Hahella chejuensis KCTC 2396	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	* Oceanospirillum sp. MED92 Site: position = -35 score = 5.90339 sequence = ATATTGTTATGGTATAACATTTA Site: position = -138 score = 5.26583 sequence = GCAATGTTATAATATAGCAATTA Gene: MED92_02998: ribosomal protein, L31P family protein	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297	Alcanivorax borkumensis SK2	ribosomal protein, L31P family protein

CRON 6.
znuA	2 Hahella chejuensis KCTC 2396* Site: position = -84 score = 6.32725 sequence = GATATGTTACATCATAACATTTT Gene: HCH_02942: Zinc ABC transporter, periplasmic-binding protein ZnuA Site: position = -64 score = 6.26484 sequence = ATAATGTTATGTTATAACCTTTC Gene: HCH_02413: Zinc ABC transporter, periplasmic-binding protein ZnuA	* Marinobacter aqueolei Site: position = -48 score = 6.29865 sequence = ATATTGTTATATTATAACGTTTC Gene: Maqu_1892: Zinc ABC transporter, periplasmic-binding protein ZnuA	2 Marinobacter sp. ELB17* Site: position = -60 score = 5.68166 sequence = GCAATGTTATAACATAACGTTCA Gene: MELB17_12891: Zinc ABC transporter, periplasmic-binding protein ZnuA Site: position = -68 score = 5.8443 sequence = GTTATGTAATATTATAACATTCT Gene: MELB17_08596: Zinc ABC transporter, periplasmic-binding protein ZnuA	Oceanobacter sp. RED65 Gene: RED65_08374: Zinc ABC transporter, periplasmic-binding protein ZnuA	* Oceanospirillum sp. MED92 Site: position = -38 score = 5.66961 sequence = TTTGTGTTATATTGTAACTTTAA Gene: MED92_05848: Zinc ABC transporter, periplasmic-binding protein ZnuA	* Marinomonas sp. MWYL1 Site: position = -40 score = 5.9036 sequence = GTATTGTTACGTTATAACATTAA Gene: Mmwyl1_1122: Zinc ABC transporter, periplasmic-binding protein ZnuA	* Saccharophagus degradans 2-40 Site: position = -80 score = 6.04233 sequence = GTTATGTTATCATATAACACTTT Gene: Sde_0060: Zinc ABC transporter, periplasmic-binding protein ZnuA	* Teredinibacter turnerae T7901 Site: position = -67 score = 6.12611 sequence = GTTATGTTATCATATAACGTTTA Gene: TERTU_0054: Zinc ABC transporter, periplasmic-binding protein ZnuA	* Cellvibrio japonicus Ueda107 Site: position = -3 score = 5.44882 sequence = GTTATGTTACTCTATAACCTTTC Gene: CJA_3480: Zinc ABC transporter, periplasmic-binding protein ZnuA	* Chromohalobacter salexigens DSM 3043 Site: position = -63 score = 5.92134 sequence = TATATGTTATAACATAACTCTTT Gene: Csal_0188: Zinc ABC transporter, periplasmic-binding protein ZnuA	* Reinekea sp. MED297 Site: position = -61 score = 5.61903 sequence = GTTATGATACATCATATCATTTA Gene: MED297_11280: Zinc ABC transporter, periplasmic-binding protein ZnuA	Alcanivorax borkumensis SK2 Gene: ABO_0155: Zinc ABC transporter, periplasmic-binding protein ZnuA	Zinc ABC transporter, periplasmic-binding protein ZnuA

CRON 7.
dksA2	Hahella chejuensis KCTC 2396 Gene: HCH_01707: C4-type zinc finger protein, DksA/TraR family	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297	* Alcanivorax borkumensis SK2 Site: position = -34 score = 5.74466 sequence = GCAATGTTATAACATAACATGAA Gene: ABO_1680: C4-type zinc finger protein, DksA/TraR family	C4-type zinc finger protein, DksA/TraR family
yciC	* Hahella chejuensis KCTC 2396 Site: position = -59 score = 6.23194 sequence = GTTTTGTTATGTTATAACATTTT Gene: HCH_02800: Putative metal chaperone, GTPase of COG0523 family	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	* Marinomonas sp. MWYL1 Site: position = -39 score = 6.61486 sequence = GAAATGTTATATCATAACATTTT Gene: Mmwyl1_1446: Putative metal chaperone, GTPase of COG0523 family	* Saccharophagus degradans 2-40 Site: position = -184 score = 5.59838 sequence = ATAATGATATCATATATCATATC Gene: Sde_1980: Putative metal chaperone, GTPase of COG0523 family	* Teredinibacter turnerae T7901 Site: position = -119 score = 5.46445 sequence = ATAATGATATGGTATATCATAAC Site: position = -114 score = 6.02538 sequence = GATATGGTATATCATAACGTTAC Gene: TERTU_2263: Putative metal chaperone, GTPase of COG0523 family	* Cellvibrio japonicus Ueda107 Site: position = -46 score = 6.14821 sequence = AATGTGTTATGTTATAACATATT Gene: CJA_3465: Putative metal chaperone, GTPase of COG0523 family	* Chromohalobacter salexigens DSM 3043 Site: position = -90 score = 5.87968 sequence = AGAATGTTATGGTATAACATATC Gene: Csal_0192: Putative metal chaperone, GTPase of COG0523 family	Reinekea sp. MED297	Alcanivorax borkumensis SK2 Gene: ABO_1679: Putative metal chaperone, GTPase of COG0523 family	Putative metal chaperone, GTPase of COG0523 family
PF08856	Hahella chejuensis KCTC 2396	Marinobacter aqueolei	Marinobacter sp. ELB17	* Oceanobacter sp. RED65 Site: position = -47 score = 4.98884 sequence = GATATAATATATCATATCTTTTA Site: position = -52 score = 5.38233 sequence = CAAAAGATATAATATATCATATC Gene: RED65_11939: hypothetical protein	* Oceanospirillum sp. MED92 Site: position = -44 score = 5.68613 sequence = GTTATGTTATATTGTATCTTTTT Site: position = -49 score = 5.07664 sequence = TTAAAGTTATGTTATATTGTATC Gene: MED92_08311: hypothetical protein	* Marinomonas sp. MWYL1 Site: position = -18 score = 5.81457 sequence = AAAATGTTATAACGTAACATGTT Site: position = -23 score = 4.6425 sequence = TTTGTAAAATGTTATAACGTAAC Gene: Mmwyl1_0929: hypothetical protein	Saccharophagus degradans 2-40 Gene: Sde_1979: hypothetical protein	Teredinibacter turnerae T7901 Gene: TERTU_2264: hypothetical protein	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297	Alcanivorax borkumensis SK2 Gene: ABO_1678: hypothetical protein	hypothetical protein
zur2	* Hahella chejuensis KCTC 2396 Site: position = -211 score = 5.70579 sequence = AAAAAGATATGATATAACGTATC Site: position = -206 score = 5.17965 sequence = GATATGATATAACGTATCTTTAT Gene: HCH_01703: Zinc uptake regulation protein ZUR	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297	Alcanivorax borkumensis SK2 Gene: ABO_1677: Zinc uptake regulation protein ZUR	Zinc uptake regulation protein ZUR
RED65_11934	Hahella chejuensis KCTC 2396	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297	Alcanivorax borkumensis SK2 Gene: ABO_1676: hypothetical protein	hypothetical protein
zbp	Hahella chejuensis KCTC 2396	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297	Alcanivorax borkumensis SK2 Gene: ABO_1675: Predicted zinc-binding protein	Predicted zinc-binding protein
ABO_1674	Hahella chejuensis KCTC 2396	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297	Alcanivorax borkumensis SK2 Gene: ABO_1674: Methionine ABC transporter ATP-binding protein	Methionine ABC transporter ATP-binding protein
ABO_1673	Hahella chejuensis KCTC 2396	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297	Alcanivorax borkumensis SK2 Gene: ABO_1673: ABC-type antimicrobial peptide transport system, permease component	ABC-type antimicrobial peptide transport system, permease component
ABO_1672	Hahella chejuensis KCTC 2396	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297	Alcanivorax borkumensis SK2 Gene: ABO_1672: lipoprotein, putative	lipoprotein, putative
hisI2	2 Hahella chejuensis KCTC 2396 Gene: HCH_01079: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) Gene: HCH_10001: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19)	Marinobacter aqueolei Gene: Maqu_3418: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19)	Marinobacter sp. ELB17 Gene: MELB17_02925: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19)	Oceanobacter sp. RED65 Gene: RED65_08999: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19)	Oceanospirillum sp. MED92 Gene: MED92_00075: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19)	Marinomonas sp. MWYL1 Gene: Mmwyl1_2431: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19)	Saccharophagus degradans 2-40 Gene: Sde_3222: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19)	Teredinibacter turnerae T7901 Gene: TERTU_3194: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19)	Cellvibrio japonicus Ueda107 Gene: CJA_0745: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19)	Chromohalobacter salexigens DSM 3043 Gene: Csal_1883: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19)	Reinekea sp. MED297 Gene: MED297_00285: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19)	Alcanivorax borkumensis SK2 Gene: ABO_2134: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19)	Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19)
pyrC2	Hahella chejuensis KCTC 2396 Gene: HCH_01704: Dihydroorotase (EC 3.5.2.3)	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	* Oceanospirillum sp. MED92 Site: position = -152 score = 5.711 sequence = TAAATGTTATACCATAACAATAT Site: position = -49 score = 5.51568 sequence = TAATTGCTATATTATAACATTGC Gene: MED92_02993: Dihydroorotase (EC 3.5.2.3)	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297	Alcanivorax borkumensis SK2 Gene: ABO_1683: Dihydroorotase (EC 3.5.2.3)	Dihydroorotase (EC 3.5.2.3)
folE2	Hahella chejuensis KCTC 2396 Gene: HCH_01706: GTP cyclohydrolase I (EC 3.5.4.16) type 2	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65 Gene: RED65_08989: GTP cyclohydrolase I (EC 3.5.4.16) type 2	Oceanospirillum sp. MED92 Gene: MED92_05463: GTP cyclohydrolase I (EC 3.5.4.16) type 2	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	2 Chromohalobacter salexigens DSM 3043 Gene: Csal_0191: GTP cyclohydrolase I (EC 3.5.4.16) type 2 Gene: Csal_0191: GTP cyclohydrolase I (EC 3.5.4.16) type 2	Reinekea sp. MED297	Alcanivorax borkumensis SK2 Gene: ABO_2144: GTP cyclohydrolase I (EC 3.5.4.16) type 2	GTP cyclohydrolase I (EC 3.5.4.16) type 2
ABO_1681	Hahella chejuensis KCTC 2396	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297	* Alcanivorax borkumensis SK2 Site: position = -51 score = 4.85293 sequence = GTTATGTTATAACATTGCATCAA Site: position = -56 score = 5.70028 sequence = TTCATGTTATGTTATAACATTGC Gene: ABO_1681: hypothetical protein	hypothetical protein
can	Hahella chejuensis KCTC 2396	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92 Gene: MED92_02988: Carbonic anhydrase (EC 4.2.1.1)	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297	Alcanivorax borkumensis SK2 Gene: ABO_1682: Carbonic anhydrase (EC 4.2.1.1)	Carbonic anhydrase (EC 4.2.1.1)

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog Zur - Oceanospirillales/Alteromonadales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --