Regulog Zur - Oceanospirillales/Alteromonadales
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Zinc homeostasis |
| Effector: | Zinc ion, (Zn2+) |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Oceanospirillales/Alteromonadales
- By trascription factor - Zur
- By TF family - FUR
- By effector - Zinc ion, (Zn2+)
- By pathway - Zinc homeostasis
| Genome | Genes | Operons |
|---|---|---|
| Hahella chejuensis KCTC 2396 | 16 | 7 |
| Marinobacter aqueolei | 2 | 2 |
| Marinobacter sp. ELB17 | 5 | 4 |
| Oceanobacter sp. RED65 | 1 | 1 |
| Oceanospirillum sp. MED92 | 9 | 6 |
| Marinomonas sp. MWYL1 | 7 | 4 |
| Saccharophagus degradans 2-40 | 6 | 3 |
| Teredinibacter turnerae T7901 | 6 | 3 |
| Cellvibrio japonicus Ueda107 | 5 | 3 |
| Chromohalobacter salexigens DSM 3043 | 6 | 4 |
| Reinekea sp. MED297 | 7 | 3 |
| Alcanivorax borkumensis SK2 | 12 | 2 |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| zbp |
*
Hahella chejuensis KCTC 2396 Site: position = -70 score = 5.71739 sequence = GTTTCGTTATGTTATAACATAAA Gene: HCH_00656: Predicted zinc-binding protein |
*
Marinobacter aqueolei Site: position = -39 score = 5.60099 sequence = AAAATGTTATAACATATCAAATA Gene: Maqu_3429: Predicted zinc-binding protein |
*
Marinobacter sp. ELB17 Site: position = -34 score = 5.86207 sequence = AAGATGTTATAACATAACTTTAC Gene: MELB17_02870: Predicted zinc-binding protein |
|
*
Oceanospirillum sp. MED92 Site: position = -28 score = 5.68266 sequence = TTGTTGTTATATTATAACTTTTA Gene: MED92_15318: Predicted zinc-binding protein |
|
Gene: Sde_1976: Predicted zinc-binding protein |
Gene: TERTU_2265: Predicted zinc-binding protein |
|
|
|
Gene: ABO_1675: Predicted zinc-binding protein |
Predicted zinc-binding protein |
| CRON 2. | |||||||||||||
| zinT |
|
|
|
|
|
|
|
|
|
*
Chromohalobacter salexigens DSM 3043 Site: position = -70 score = 5.33914 sequence = AGAAAGATATGTTATAACGTATT Gene: Csal_0187: Candidate zinc-binding lipoprotein ZinT |
|
|
Candidate zinc-binding lipoprotein ZinT |
| CRON 3. | |||||||||||||
| HCH_02943 |
*
Hahella chejuensis KCTC 2396 Site: position = -66 score = 4.93623 sequence = AAAAAGATATGATGCAACATATC Gene: HCH_02943: hypothetical protein |
|
|
|
|
|
|
|
|
|
|
|
hypothetical protein |
| omr |
Gene: HCH_02944: Zinc-regulated TonB-dependent outer membrane receptor |
|
|
|
|
|
|
|
|
|
|
|
Zinc-regulated TonB-dependent outer membrane receptor |
| znuA2 |
Gene: HCH_02945: Zinc ABC transporter, periplasmic-binding protein ZnuA |
|
|
|
|
|
|
|
|
|
|
|
Zinc ABC transporter, periplasmic-binding protein ZnuA |
| znuB2 |
Gene: HCH_02946: Zinc ABC transporter, inner membrane permease protein ZnuB |
|
|
|
|
|
|
|
|
|
|
|
Zinc ABC transporter, inner membrane permease protein ZnuB |
| CRON 4. | |||||||||||||
| znuC |
2
Hahella chejuensis KCTC 2396 Gene: HCH_00536: Zinc ABC transporter, ATP-binding protein ZnuC Gene: HCH_02940: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: Maqu_3776: Zinc ABC transporter, ATP-binding protein ZnuC |
*2
Marinobacter sp. ELB17 Site: position = -102 score = 5.5346 sequence = TGAACGTTATGTTATAACATTGC Gene: MELB17_12886: Zinc ABC transporter, ATP-binding protein ZnuC Gene: MELB17_01715: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: RED65_08379: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: MED92_05838: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: Mmwyl1_0293: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: Sde_0058: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: TERTU_0052: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: CJA_3483: Zinc ABC transporter, ATP-binding protein ZnuC |
*
Chromohalobacter salexigens DSM 3043 Site: position = -56 score = 5.86682 sequence = AAAGAGTTATGTTATAACATATA Gene: Csal_0189: Zinc ABC transporter, ATP-binding protein ZnuC |
*
Reinekea sp. MED297 Site: position = -124 score = 5.38642 sequence = TAAATGATATGATGTATCATAAC Site: position = -119 score = 5.15138 sequence = GATATGATGTATCATAACAAATA Gene: MED297_11285: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: ABO_0156: Zinc ABC transporter, ATP-binding protein ZnuC |
Zinc ABC transporter, ATP-binding protein ZnuC |
| znuB |
2
Hahella chejuensis KCTC 2396 Gene: HCH_00535: Zinc ABC transporter, inner membrane permease protein ZnuB Gene: HCH_02939: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: Maqu_3777: Zinc ABC transporter, inner membrane permease protein ZnuB |
2
Marinobacter sp. ELB17 Gene: MELB17_12881: Zinc ABC transporter, inner membrane permease protein ZnuB Gene: MELB17_01710: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: RED65_08384: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: MED92_05833: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: Mmwyl1_0294: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: Sde_0057: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: TERTU_0051: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: CJA_3484: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: Csal_0190: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: MED297_11290: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: ABO_0157: Zinc ABC transporter, inner membrane permease protein ZnuB |
Zinc ABC transporter, inner membrane permease protein ZnuB |
| yciC |
|
|
|
|
|
|
|
|
|
|
Gene: MED297_11295: Putative metal chaperone, GTPase of COG0523 family |
|
Putative metal chaperone, GTPase of COG0523 family |
| PF08856 |
|
|
|
|
|
|
|
|
|
|
Gene: MED297_11300: hypothetical protein |
|
hypothetical protein |
| zur |
*
Hahella chejuensis KCTC 2396 Site: position = -80 score = 5.34799 sequence = CAATTGTTATAACATTACACTTC Gene: HCH_00537: Zinc uptake regulation protein ZUR |
Gene: Maqu_3775: Zinc uptake regulation protein ZUR |
Gene: MELB17_01720: Zinc uptake regulation protein ZUR |
|
*
Oceanospirillum sp. MED92 Site: position = -43 score = 5.60068 sequence = TTAAAGTTACAATATAACACAAA Gene: MED92_05843: Zinc uptake regulation protein ZUR |
Gene: Mmwyl1_0292: Zinc uptake regulation protein ZUR |
*
Saccharophagus degradans 2-40 Site: position = -51 score = 6.05745 sequence = AAAGTGTTATATGATAACATAAC Gene: Sde_0059: Zinc uptake regulation protein ZUR |
*
Teredinibacter turnerae T7901 Site: position = -51 score = 5.95491 sequence = TAAACGTTATATGATAACATAAC Gene: TERTU_0053: Zinc uptake regulation protein ZUR |
*
Cellvibrio japonicus Ueda107 Site: position = -53 score = 5.27147 sequence = GAAAGGTTATAGAGTAACATAAC Gene: CJA_3482: Zinc uptake regulation protein ZUR |
Gene: Csal_1882: Zinc uptake regulation protein ZUR |
Gene: MED297_11305: Zinc uptake regulation protein ZUR |
|
Zinc uptake regulation protein ZUR |
| Mmwyl1_0291 |
|
|
|
|
|
*
Marinomonas sp. MWYL1 Site: position = -51 score = 5.20792 sequence = TACTTGTTATATCATAACAAAAT Gene: Mmwyl1_0291: putative membrane protein |
|
|
|
|
|
|
putative membrane protein |
| zur2 |
|
|
|
Gene: RED65_11929: Zinc uptake regulation protein paralog |
|
|
Gene: Sde_1974: Zinc uptake regulation protein paralog |
Gene: TERTU_3389: Zinc uptake regulation protein paralog |
|
|
*
Reinekea sp. MED297 Site: position = -77 score = 5.85057 sequence = TTAATGATATATCATATCATTTA Gene: MED297_00400: Zinc uptake regulation protein paralog |
|
Zinc uptake regulation protein paralog |
| CRON 5. | |||||||||||||
| rpmE2 |
|
|
|
|
*
Oceanospirillum sp. MED92 Site: position = -35 score = 5.90339 sequence = ATATTGTTATGGTATAACATTTA Site: position = -138 score = 5.26583 sequence = GCAATGTTATAATATAGCAATTA Gene: MED92_02998: ribosomal protein, L31P family protein |
|
|
|
|
|
|
|
ribosomal protein, L31P family protein |
| CRON 6. | |||||||||||||
| znuA |
*2
Hahella chejuensis KCTC 2396 Site: position = -84 score = 6.32725 sequence = GATATGTTACATCATAACATTTT Gene: HCH_02942: Zinc ABC transporter, periplasmic-binding protein ZnuA Site: position = -64 score = 6.26484 sequence = ATAATGTTATGTTATAACCTTTC Gene: HCH_02413: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Marinobacter aqueolei Site: position = -48 score = 6.29865 sequence = ATATTGTTATATTATAACGTTTC Gene: Maqu_1892: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*2
Marinobacter sp. ELB17 Site: position = -60 score = 5.68166 sequence = GCAATGTTATAACATAACGTTCA Gene: MELB17_12891: Zinc ABC transporter, periplasmic-binding protein ZnuA Site: position = -68 score = 5.8443 sequence = GTTATGTAATATTATAACATTCT Gene: MELB17_08596: Zinc ABC transporter, periplasmic-binding protein ZnuA |
Gene: RED65_08374: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Oceanospirillum sp. MED92 Site: position = -38 score = 5.66961 sequence = TTTGTGTTATATTGTAACTTTAA Gene: MED92_05848: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Marinomonas sp. MWYL1 Site: position = -40 score = 5.9036 sequence = GTATTGTTACGTTATAACATTAA Gene: Mmwyl1_1122: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Saccharophagus degradans 2-40 Site: position = -80 score = 6.04233 sequence = GTTATGTTATCATATAACACTTT Gene: Sde_0060: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Teredinibacter turnerae T7901 Site: position = -67 score = 6.12611 sequence = GTTATGTTATCATATAACGTTTA Gene: TERTU_0054: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Cellvibrio japonicus Ueda107 Site: position = -3 score = 5.44882 sequence = GTTATGTTACTCTATAACCTTTC Gene: CJA_3480: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Chromohalobacter salexigens DSM 3043 Site: position = -63 score = 5.92134 sequence = TATATGTTATAACATAACTCTTT Gene: Csal_0188: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Reinekea sp. MED297 Site: position = -61 score = 5.61903 sequence = GTTATGATACATCATATCATTTA Gene: MED297_11280: Zinc ABC transporter, periplasmic-binding protein ZnuA |
Gene: ABO_0155: Zinc ABC transporter, periplasmic-binding protein ZnuA |
Zinc ABC transporter, periplasmic-binding protein ZnuA |
| CRON 7. | |||||||||||||
| dksA2 |
Gene: HCH_01707: C4-type zinc finger protein, DksA/TraR family |
|
|
|
|
|
|
|
|
|
|
*
Alcanivorax borkumensis SK2 Site: position = -34 score = 5.74466 sequence = GCAATGTTATAACATAACATGAA Gene: ABO_1680: C4-type zinc finger protein, DksA/TraR family |
C4-type zinc finger protein, DksA/TraR family |
| yciC |
*
Hahella chejuensis KCTC 2396 Site: position = -59 score = 6.23194 sequence = GTTTTGTTATGTTATAACATTTT Gene: HCH_02800: Putative metal chaperone, GTPase of COG0523 family |
|
|
|
|
*
Marinomonas sp. MWYL1 Site: position = -39 score = 6.61486 sequence = GAAATGTTATATCATAACATTTT Gene: Mmwyl1_1446: Putative metal chaperone, GTPase of COG0523 family |
*
Saccharophagus degradans 2-40 Site: position = -184 score = 5.59838 sequence = ATAATGATATCATATATCATATC Gene: Sde_1980: Putative metal chaperone, GTPase of COG0523 family |
*
Teredinibacter turnerae T7901 Site: position = -119 score = 5.46445 sequence = ATAATGATATGGTATATCATAAC Site: position = -114 score = 6.02538 sequence = GATATGGTATATCATAACGTTAC Gene: TERTU_2263: Putative metal chaperone, GTPase of COG0523 family |
*
Cellvibrio japonicus Ueda107 Site: position = -46 score = 6.14821 sequence = AATGTGTTATGTTATAACATATT Gene: CJA_3465: Putative metal chaperone, GTPase of COG0523 family |
*
Chromohalobacter salexigens DSM 3043 Site: position = -90 score = 5.87968 sequence = AGAATGTTATGGTATAACATATC Gene: Csal_0192: Putative metal chaperone, GTPase of COG0523 family |
|
Gene: ABO_1679: Putative metal chaperone, GTPase of COG0523 family |
Putative metal chaperone, GTPase of COG0523 family |
| PF08856 |
|
|
|
*
Oceanobacter sp. RED65 Site: position = -47 score = 4.98884 sequence = GATATAATATATCATATCTTTTA Site: position = -52 score = 5.38233 sequence = CAAAAGATATAATATATCATATC Gene: RED65_11939: hypothetical protein |
*
Oceanospirillum sp. MED92 Site: position = -44 score = 5.68613 sequence = GTTATGTTATATTGTATCTTTTT Site: position = -49 score = 5.07664 sequence = TTAAAGTTATGTTATATTGTATC Gene: MED92_08311: hypothetical protein |
*
Marinomonas sp. MWYL1 Site: position = -18 score = 5.81457 sequence = AAAATGTTATAACGTAACATGTT Site: position = -23 score = 4.6425 sequence = TTTGTAAAATGTTATAACGTAAC Gene: Mmwyl1_0929: hypothetical protein |
Gene: Sde_1979: hypothetical protein |
Gene: TERTU_2264: hypothetical protein |
|
|
|
Gene: ABO_1678: hypothetical protein |
hypothetical protein |
| zur2 |
*
Hahella chejuensis KCTC 2396 Site: position = -211 score = 5.70579 sequence = AAAAAGATATGATATAACGTATC Site: position = -206 score = 5.17965 sequence = GATATGATATAACGTATCTTTAT Gene: HCH_01703: Zinc uptake regulation protein ZUR |
|
|
|
|
|
|
|
|
|
|
Gene: ABO_1677: Zinc uptake regulation protein ZUR |
Zinc uptake regulation protein ZUR |
| RED65_11934 |
|
|
|
|
|
|
|
|
|
|
|
Gene: ABO_1676: hypothetical protein |
hypothetical protein |
| zbp |
|
|
|
|
|
|
|
|
|
|
|
Gene: ABO_1675: Predicted zinc-binding protein |
Predicted zinc-binding protein |
| ABO_1674 |
|
|
|
|
|
|
|
|
|
|
|
Gene: ABO_1674: Methionine ABC transporter ATP-binding protein |
Methionine ABC transporter ATP-binding protein |
| ABO_1673 |
|
|
|
|
|
|
|
|
|
|
|
Gene: ABO_1673: ABC-type antimicrobial peptide transport system, permease component |
ABC-type antimicrobial peptide transport system, permease component |
| ABO_1672 |
|
|
|
|
|
|
|
|
|
|
|
Gene: ABO_1672: lipoprotein, putative |
lipoprotein, putative |
| hisI2 |
2
Hahella chejuensis KCTC 2396 Gene: HCH_01079: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) Gene: HCH_10001: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) |
Gene: Maqu_3418: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) |
Gene: MELB17_02925: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) |
Gene: RED65_08999: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) |
Gene: MED92_00075: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) |
Gene: Mmwyl1_2431: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) |
Gene: Sde_3222: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) |
Gene: TERTU_3194: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) |
Gene: CJA_0745: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) |
Gene: Csal_1883: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) |
Gene: MED297_00285: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) |
Gene: ABO_2134: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) |
Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) |
| pyrC2 |
Gene: HCH_01704: Dihydroorotase (EC 3.5.2.3) |
|
|
|
*
Oceanospirillum sp. MED92 Site: position = -152 score = 5.711 sequence = TAAATGTTATACCATAACAATAT Site: position = -49 score = 5.51568 sequence = TAATTGCTATATTATAACATTGC Gene: MED92_02993: Dihydroorotase (EC 3.5.2.3) |
|
|
|
|
|
|
Gene: ABO_1683: Dihydroorotase (EC 3.5.2.3) |
Dihydroorotase (EC 3.5.2.3) |
| folE2 |
Gene: HCH_01706: GTP cyclohydrolase I (EC 3.5.4.16) type 2 |
|
|
Gene: RED65_08989: GTP cyclohydrolase I (EC 3.5.4.16) type 2 |
Gene: MED92_05463: GTP cyclohydrolase I (EC 3.5.4.16) type 2 |
|
|
|
|
2
Chromohalobacter salexigens DSM 3043 Gene: Csal_0191: GTP cyclohydrolase I (EC 3.5.4.16) type 2 Gene: Csal_0191: GTP cyclohydrolase I (EC 3.5.4.16) type 2 |
|
Gene: ABO_2144: GTP cyclohydrolase I (EC 3.5.4.16) type 2 |
GTP cyclohydrolase I (EC 3.5.4.16) type 2 |
| ABO_1681 |
|
|
|
|
|
|
|
|
|
|
|
*
Alcanivorax borkumensis SK2 Site: position = -51 score = 4.85293 sequence = GTTATGTTATAACATTGCATCAA Site: position = -56 score = 5.70028 sequence = TTCATGTTATGTTATAACATTGC Gene: ABO_1681: hypothetical protein |
hypothetical protein |
| can |
|
|
|
|
Gene: MED92_02988: Carbonic anhydrase (EC 4.2.1.1) |
|
|
|
|
|
|
Gene: ABO_1682: Carbonic anhydrase (EC 4.2.1.1) |
Carbonic anhydrase (EC 4.2.1.1) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |