Regulon of Zur in Cellvibrio japonicus Ueda107

Properties
Regulator type:	Transcription factor
TF locus tag:	CJA_3482
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Oceanospirillales/Alteromonadales
Statistics of regulated genes:
- Genes	5
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 51 sites [see more]

Member of regulog collections

By taxonomy - Oceanospirillales/Alteromonadales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -3 Score: 5.4 Sequence: GTTATGTTACTCTATAACCTTTC Locus tag: CJA_3480 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	CJA_3480	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
Position: -53 Score: 5.3 Sequence: GAAAGGTTATAGAGTAACATAAC Locus tag: CJA_3482 Name: zur Funciton: Zinc uptake regulation protein ZUR Locus tag: CJA_3483 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: CJA_3484 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	CJA_3482	zur	Zinc uptake regulation protein ZUR
	CJA_3483	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	CJA_3484	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
Position: -46 Score: 6.1 Sequence: AATGTGTTATGTTATAACATATT Locus tag: CJA_3465 Name: yciC Funciton: Putative metal chaperone, GTPase of COG0523 family
	CJA_3465	yciC	Putative metal chaperone, GTPase of COG0523 family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD