Regulon of Zur in Chromohalobacter salexigens DSM 3043

Properties
Regulator type:	Transcription factor
TF locus tag:	Csal_1882
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Oceanospirillales/Alteromonadales
Statistics of regulated genes:
- Genes	6
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 51 sites [see more]

Member of regulog collections

By taxonomy - Oceanospirillales/Alteromonadales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -70 Score: 5.3 Sequence: AGAAAGATATGTTATAACGTATT Locus tag: Csal_0187 Name: zinT Funciton: Candidate zinc-binding lipoprotein ZinT
	Csal_0187	zinT	Candidate zinc-binding lipoprotein ZinT
Position: -63 Score: 5.9 Sequence: TATATGTTATAACATAACTCTTT Locus tag: Csal_0188 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	Csal_0188	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
Position: -56 Score: 5.9 Sequence: AAAGAGTTATGTTATAACATATA Locus tag: Csal_0189 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: Csal_0190 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	Csal_0189	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	Csal_0190	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
Position: -90 Score: 5.9 Sequence: AGAATGTTATGGTATAACATATC Locus tag: Csal_0192 Name: yciC Funciton: Putative metal chaperone, GTPase of COG0523 family Locus tag: Csal_0191 Name: folE2 Funciton: GTP cyclohydrolase I (EC 3.5.4.16) type 2
	Csal_0192	yciC	Putative metal chaperone, GTPase of COG0523 family
	Csal_0191	folE2	GTP cyclohydrolase I (EC 3.5.4.16) type 2

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD