Regulon of Zur in Oceanospirillum sp. MED92

Properties
Regulator type:	Transcription factor
TF locus tag:	MED92_05843
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Oceanospirillales/Alteromonadales
Statistics of regulated genes:
- Genes	9
- Operons	6
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 51 sites [see more]

Member of regulog collections

By taxonomy - Oceanospirillales/Alteromonadales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -152 Score: 5.7 Sequence: TAAATGTTATACCATAACAATAT Position: -49 Score: 5.5 Sequence: TAATTGCTATATTATAACATTGC Locus tag: MED92_02993 Name: pyrC2 Funciton: Dihydroorotase (EC 3.5.2.3) Locus tag: MED92_02988 Name: can Funciton: Carbonic anhydrase (EC 4.2.1.1)
	MED92_02993	pyrC2	Dihydroorotase (EC 3.5.2.3)
	MED92_02988	can	Carbonic anhydrase (EC 4.2.1.1)
Position: -38 Score: 5.7 Sequence: TTTGTGTTATATTGTAACTTTAA Locus tag: MED92_05848 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	MED92_05848	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
Position: -43 Score: 5.6 Sequence: TTAAAGTTACAATATAACACAAA Locus tag: MED92_05843 Name: zur Funciton: Zinc uptake regulation protein ZUR Locus tag: MED92_05838 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: MED92_05833 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	MED92_05843	zur	Zinc uptake regulation protein ZUR
	MED92_05838	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	MED92_05833	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
Position: -138 Score: 5.3 Sequence: GCAATGTTATAATATAGCAATTA Position: -35 Score: 5.9 Sequence: ATATTGTTATGGTATAACATTTA Locus tag: MED92_02998 Name: null Funciton: ribosomal protein, L31P family protein
	MED92_02998		ribosomal protein, L31P family protein
Position: -28 Score: 5.7 Sequence: TTGTTGTTATATTATAACTTTTA Locus tag: MED92_15318 Name: zbp Funciton: Predicted zinc-binding protein
	MED92_15318	zbp	Predicted zinc-binding protein
Position: -49 Score: 5.1 Sequence: TTAAAGTTATGTTATATTGTATC Position: -44 Score: 5.7 Sequence: GTTATGTTATATTGTATCTTTTT Locus tag: MED92_08311 Name: PF08856 Funciton: hypothetical protein
	MED92_08311	PF08856	hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD