Orthologous regulated operons containing Mmwyl1_0291 gene

Properties
Regulog:	Zur - Oceanospirillales/Alteromonadales
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Phylum:	Proteobacteria/gamma

Built upon 51 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Marinomonas sp. MWYL1
Position: -51 Score: 5.20792 Sequence: TACTTGTTATATCATAACAAAAT Locus tag: Mmwyl1_0291 Name: null Funciton: putative membrane protein Locus tag: Mmwyl1_0292 Name: zur Funciton: Zinc uptake regulation protein ZUR Locus tag: Mmwyl1_0293 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: Mmwyl1_0294 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Mmwyl1_0291-zur-znuC-znuB	-51	5.2	TACTTGTTATATCATAACAAAAT	Mmwyl1_0291

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --