Regulon of Zur in Marinobacter aqueolei

Properties
Regulator type:	Transcription factor
TF locus tag:	Maqu_3775
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Oceanospirillales/Alteromonadales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 51 sites [see more]

Member of regulog collections

By taxonomy - Oceanospirillales/Alteromonadales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -48 Score: 6.3 Sequence: ATATTGTTATATTATAACGTTTC Locus tag: Maqu_1892 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	Maqu_1892	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
Position: -39 Score: 5.6 Sequence: AAAATGTTATAACATATCAAATA Locus tag: Maqu_3429 Name: zbp Funciton: Predicted zinc-binding protein
	Maqu_3429	zbp	Predicted zinc-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD