Regulon of Zur in Oceanobacter sp. RED65

Properties
Regulator type:	Transcription factor
TF locus tag:	RED65_11929
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Oceanospirillales/Alteromonadales
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 51 sites [see more]

Member of regulog collections

By taxonomy - Oceanospirillales/Alteromonadales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -52 Score: 5.4 Sequence: CAAAAGATATAATATATCATATC Position: -47 Score: 5 Sequence: GATATAATATATCATATCTTTTA Locus tag: RED65_11939 Name: PF08856 Funciton: hypothetical protein
	RED65_11939	PF08856	hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD