Regulon of Zur in Reinekea sp. MED297

Properties
Regulator type:	Transcription factor
TF locus tag:	MED297_11305, MED297_00400
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Oceanospirillales/Alteromonadales
Statistics of regulated genes:
- Genes	7
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 51 sites [see more]

Member of regulog collections

By taxonomy - Oceanospirillales/Alteromonadales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -61 Score: 5.6 Sequence: GTTATGATACATCATATCATTTA Locus tag: MED297_11280 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	MED297_11280	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
Position: -77 Score: 5.9 Sequence: TTAATGATATATCATATCATTTA Locus tag: MED297_00400 Name: zur2 Funciton: Zinc uptake regulation protein paralog
	MED297_00400	zur2	Zinc uptake regulation protein paralog
Position: -124 Score: 5.4 Sequence: TAAATGATATGATGTATCATAAC Position: -119 Score: 5.2 Sequence: GATATGATGTATCATAACAAATA Locus tag: MED297_11285 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: MED297_11290 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: MED297_11295 Name: yciC Funciton: Putative metal chaperone, GTPase of COG0523 family Locus tag: MED297_11300 Name: PF08856 Funciton: hypothetical protein Locus tag: MED297_11305 Name: zur Funciton: Zinc uptake regulation protein ZUR
	MED297_11285	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	MED297_11290	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
	MED297_11295	yciC	Putative metal chaperone, GTPase of COG0523 family
	MED297_11300	PF08856	hypothetical protein
	MED297_11305	zur	Zinc uptake regulation protein ZUR

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD