Regulon of Zur in Marinobacter sp. ELB17

Properties
Regulator type:	Transcription factor
TF locus tag:	MELB17_01720
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Oceanospirillales/Alteromonadales
Statistics of regulated genes:
- Genes	5
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 51 sites [see more]

Member of regulog collections

By taxonomy - Oceanospirillales/Alteromonadales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -60 Score: 5.7 Sequence: GCAATGTTATAACATAACGTTCA Locus tag: MELB17_12891 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	MELB17_12891	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
Position: -68 Score: 5.8 Sequence: GTTATGTAATATTATAACATTCT Locus tag: MELB17_08596 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	MELB17_08596	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
Position: -102 Score: 5.5 Sequence: TGAACGTTATGTTATAACATTGC Locus tag: MELB17_12886 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: MELB17_12881 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	MELB17_12886	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	MELB17_12881	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
Position: -34 Score: 5.9 Sequence: AAGATGTTATAACATAACTTTAC Locus tag: MELB17_02870 Name: zbp Funciton: Predicted zinc-binding protein
	MELB17_02870	zbp	Predicted zinc-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD