Regulon of Zur in Saccharophagus degradans 2-40

Properties
Regulator type:	Transcription factor
TF locus tag:	Sde_1974, Sde_0059
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Oceanospirillales/Alteromonadales
Statistics of regulated genes:
- Genes	6
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 51 sites [see more]

Member of regulog collections

By taxonomy - Oceanospirillales/Alteromonadales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -80 Score: 6 Sequence: GTTATGTTATCATATAACACTTT Locus tag: Sde_0060 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	Sde_0060	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
Position: -184 Score: 5.6 Sequence: ATAATGATATCATATATCATATC Locus tag: Sde_1980 Name: yciC Funciton: Putative metal chaperone, GTPase of COG0523 family Locus tag: Sde_1979 Name: PF08856 Funciton: hypothetical protein
	Sde_1980	yciC	Putative metal chaperone, GTPase of COG0523 family
	Sde_1979	PF08856	hypothetical protein
Position: -51 Score: 6.1 Sequence: AAAGTGTTATATGATAACATAAC Locus tag: Sde_0059 Name: zur Funciton: Zinc uptake regulation protein ZUR Locus tag: Sde_0058 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: Sde_0057 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	Sde_0059	zur	Zinc uptake regulation protein ZUR
	Sde_0058	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	Sde_0057	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD