Regulon of Zur in Marinomonas sp. MWYL1

Properties
Regulator type:	Transcription factor
TF locus tag:	Mmwyl1_0292
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Oceanospirillales/Alteromonadales
Statistics of regulated genes:
- Genes	7
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 51 sites [see more]

Member of regulog collections

By taxonomy - Oceanospirillales/Alteromonadales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -40 Score: 5.9 Sequence: GTATTGTTACGTTATAACATTAA Locus tag: Mmwyl1_1122 Name: null Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	Mmwyl1_1122		Zinc ABC transporter, periplasmic-binding protein ZnuA
Position: -51 Score: 5.2 Sequence: TACTTGTTATATCATAACAAAAT Locus tag: Mmwyl1_0291 Name: null Funciton: putative membrane protein Locus tag: Mmwyl1_0292 Name: zur Funciton: Zinc uptake regulation protein ZUR Locus tag: Mmwyl1_0293 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: Mmwyl1_0294 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	Mmwyl1_0291		putative membrane protein
	Mmwyl1_0292	zur	Zinc uptake regulation protein ZUR
	Mmwyl1_0293	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	Mmwyl1_0294	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
Position: -39 Score: 6.6 Sequence: GAAATGTTATATCATAACATTTT Locus tag: Mmwyl1_1446 Name: yciC Funciton: Putative metal chaperone, GTPase of COG0523 family
	Mmwyl1_1446	yciC	Putative metal chaperone, GTPase of COG0523 family
Position: -23 Score: 4.6 Sequence: TTTGTAAAATGTTATAACGTAAC Position: -18 Score: 5.8 Sequence: AAAATGTTATAACGTAACATGTT Locus tag: Mmwyl1_0929 Name: PF08856 Funciton: hypothetical protein
	Mmwyl1_0929	PF08856	hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD