Regulog PhrR - Pseudomonadaceae

Properties
Regulator type:	Transcription factor
Regulator family:	MerR
Regulation mode:	repressor
Biological process:	Light-dependent DNA repair
Effector:	Blue light; Adenosylcobalamin
Phylum:	Proteobacteria/Gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 43 sites [see more]

Member of regulog collections

By taxonomy - Pseudomonadaceae
By trascription factor - PhrR
By TF family - MerR
By effector - Blue light
By effector - Adenosylcobalamin
By pathway - Light-dependent DNA repair

Statistics of regulated genes
Genome	Genes	Operons
Azotobacter vinelandii AvOP	7	2
Pseudomonas aeruginosa PAO1	4	2
Pseudomonas entomophila L48	17	5
Pseudomonas fluorescens Pf-5	17	5
Pseudomonas mendocina ymp	19	5
Pseudomonas putida KT2440	15	5
Pseudomonas stutzeri A1501	13	3
Pseudomonas syringae pv. tomato str. DC3000	19	5

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes									Function

CRON 1.
COG1090	Azotobacter vinelandii AvOP Gene: Avin_41380: Predicted nucleoside-diphosphate sugar epimerase	Pseudomonas aeruginosa PAO1 Gene: PA4656: Predicted nucleoside-diphosphate sugar epimerase	* Pseudomonas entomophila L48 Site: position = -137 score = 5.48454 sequence = TGTACAATGCACAATGTTTGTATA Gene: PSEEN0885: Predicted nucleoside-diphosphate sugar epimerase	* Pseudomonas fluorescens Pf-5 Site: position = -147 score = 5.57655 sequence = TGTACAATATTGTTTTTTGGTATA Gene: PFL_5142: Predicted nucleoside-diphosphate sugar epimerase	* Pseudomonas mendocina ymp Site: position = -131 score = 6.13282 sequence = TATACAAGAATGTTTTCATGTACA Gene: Pmen_1076: Predicted nucleoside-diphosphate sugar epimerase	* Pseudomonas putida KT2440 Site: position = -136 score = 5.30897 sequence = TGTACAATGCCAAAATTATGTATA Gene: PP0743: Predicted nucleoside-diphosphate sugar epimerase	* Pseudomonas stutzeri A1501 Site: position = -85 score = 5.21713 sequence = TGTACATTCGAATAACCATGTATA Gene: PST_1967: Predicted nucleoside-diphosphate sugar epimerase	* Pseudomonas syringae pv. tomato str. DC3000 Site: position = -240 score = 5.50449 sequence = TGTACAATCTTCTTGTTTGGTATA Gene: PSPTO1127: Predicted nucleoside-diphosphate sugar epimerase	Predicted nucleoside-diphosphate sugar epimerase
hemH	Azotobacter vinelandii AvOP Gene: Avin_41370: Ferrochelatase, protoheme ferro-lyase (EC 4.99.1.1)	Pseudomonas aeruginosa PAO1 Gene: PA4655: Ferrochelatase, protoheme ferro-lyase (EC 4.99.1.1)	Pseudomonas entomophila L48 Gene: PSEEN0886: Ferrochelatase, protoheme ferro-lyase (EC 4.99.1.1)	Pseudomonas fluorescens Pf-5 Gene: PFL_5141: Ferrochelatase, protoheme ferro-lyase (EC 4.99.1.1)	Pseudomonas mendocina ymp Gene: Pmen_1077: Ferrochelatase, protoheme ferro-lyase (EC 4.99.1.1)	Pseudomonas putida KT2440 Gene: PP0744: Ferrochelatase, protoheme ferro-lyase (EC 4.99.1.1)	Pseudomonas stutzeri A1501 Gene: PST_1968: Ferrochelatase, protoheme ferro-lyase (EC 4.99.1.1)	Pseudomonas syringae pv. tomato str. DC3000 Gene: PSPTO1128: Ferrochelatase, protoheme ferro-lyase (EC 4.99.1.1)	Ferrochelatase, protoheme ferro-lyase (EC 4.99.1.1)

CRON 2.
folM	* Azotobacter vinelandii AvOP Site: position = -78 score = 4.40369 sequence = TGTACAAAGCGGGACACTGCTATA Gene: Avin_10270: FolM Alternative dihydrofolate reductase 1	Pseudomonas aeruginosa PAO1 Gene: PA3437: FolM Alternative dihydrofolate reductase 1	Pseudomonas entomophila L48 Gene: PSEEN4623: FolM Alternative dihydrofolate reductase 1	Pseudomonas fluorescens Pf-5 Gene: PFL_0950: FolM Alternative dihydrofolate reductase 1	* Pseudomonas mendocina ymp Site: position = -251 score = 5.58199 sequence = TGTACAAAACACATGGATCGTACA Site: position = -118 score = 4.56068 sequence = TGTACAACCCGCAGCTCTGGTATA Gene: Pmen_3288: FolM Alternative dihydrofolate reductase 1	Pseudomonas putida KT2440 Gene: PP4632: FolM Alternative dihydrofolate reductase 1	Pseudomonas stutzeri A1501 Gene: PST_1136: FolM Alternative dihydrofolate reductase 1	* Pseudomonas syringae pv. tomato str. DC3000 Site: position = -101 score = 6.0939 sequence = TGTACAAAAAAATTCTCTGGTATA Gene: PSPTO1183: FolM Alternative dihydrofolate reductase 1	FolM Alternative dihydrofolate reductase 1
folE	Azotobacter vinelandii AvOP	Pseudomonas aeruginosa PAO1 Gene: PA3438: GTP cyclohydrolase I (EC 3.5.4.16) type 1	Pseudomonas entomophila L48	2 Pseudomonas fluorescens Pf-5* Gene: PFL_0949: GTP cyclohydrolase I (EC 3.5.4.16) type 1 Site: position = -229 score = 4.25293 sequence = TGTACAGATAAAAAGTATTGAATC Site: position = -190 score = 4.81819 sequence = TGTACAAGTATTTGGGCTTATAAG Site: position = -145 score = 4.3812 sequence = TGTACAAAAAATTAAATTGTCGTA Gene: PFL_2258: GTP cyclohydrolase I (EC 3.5.4.16) type 1	Pseudomonas mendocina ymp Gene: Pmen_3289: GTP cyclohydrolase I (EC 3.5.4.16) type 1	Pseudomonas putida KT2440 Gene: PP2512: GTP cyclohydrolase I (EC 3.5.4.16) type 1	Pseudomonas stutzeri A1501	Pseudomonas syringae pv. tomato str. DC3000 Gene: PSPTO1182: GTP cyclohydrolase I (EC 3.5.4.16) type 1	GTP cyclohydrolase I (EC 3.5.4.16) type 1
folB	Azotobacter vinelandii AvOP Gene: Avin_10260: Dihydroneopterin triphosphate epimerase	Pseudomonas aeruginosa PAO1 Gene: PA3439: Dihydroneopterin triphosphate epimerase	Pseudomonas entomophila L48	Pseudomonas fluorescens Pf-5 Gene: PFL_0948: Dihydroneopterin triphosphate epimerase	Pseudomonas mendocina ymp Gene: Pmen_3290: Dihydroneopterin triphosphate epimerase	Pseudomonas putida KT2440	Pseudomonas stutzeri A1501 Gene: PST_1135: Dihydroneopterin triphosphate epimerase	Pseudomonas syringae pv. tomato str. DC3000 Gene: PSPTO1181: Dihydroneopterin triphosphate epimerase	Dihydroneopterin triphosphate epimerase
PF06844	Azotobacter vinelandii AvOP Gene: Avin_10250: protein of unknown function DUF1244	Pseudomonas aeruginosa PAO1 Gene: PA3440: protein of unknown function DUF1244	Pseudomonas entomophila L48 Gene: PSEEN4624: protein of unknown function DUF1244	Pseudomonas fluorescens Pf-5 Gene: PFL_0947: protein of unknown function DUF1244	Pseudomonas mendocina ymp Gene: Pmen_3291: protein of unknown function DUF1244	Pseudomonas putida KT2440 Gene: PP4633: protein of unknown function DUF1244	Pseudomonas stutzeri A1501 Gene: PST_1134: protein of unknown function DUF1244	Pseudomonas syringae pv. tomato str. DC3000 Gene: PSPTO1180: protein of unknown function DUF1244	protein of unknown function DUF1244
PF08888	Azotobacter vinelandii AvOP Gene: Avin_10240: HopJ type III effector protein	Pseudomonas aeruginosa PAO1	Pseudomonas entomophila L48 Gene: PSEEN4625: HopJ type III effector protein	Pseudomonas fluorescens Pf-5 Gene: PFL_0946: HopJ type III effector protein	Pseudomonas mendocina ymp Gene: Pmen_3292: HopJ type III effector protein	Pseudomonas putida KT2440	Pseudomonas stutzeri A1501 Gene: PST_1133: HopJ type III effector protein	Pseudomonas syringae pv. tomato str. DC3000 Gene: PSPTO1179: HopJ type III effector protein	HopJ type III effector protein
PSEEN2737	Azotobacter vinelandii AvOP	Pseudomonas aeruginosa PAO1	* Pseudomonas entomophila L48 Site: position = -49 score = 6.31376 sequence = TGTACAAGAACCTAGTCTTGTACA Gene: PSEEN2737: FIG026291: Hypothetical periplasmic protein	Pseudomonas fluorescens Pf-5 Gene: PFL_2259: FIG026291: Hypothetical periplasmic protein	Pseudomonas mendocina ymp Gene: Pmen_3102: FIG026291: Hypothetical periplasmic protein	Pseudomonas putida KT2440 Gene: PP2729: FIG026291: Hypothetical periplasmic protein	Pseudomonas stutzeri A1501	Pseudomonas syringae pv. tomato str. DC3000 Gene: PSPTO2514: FIG026291: Hypothetical periplasmic protein	FIG026291: Hypothetical periplasmic protein
PF12915	Azotobacter vinelandii AvOP	Pseudomonas aeruginosa PAO1	Pseudomonas entomophila L48 Gene: PSEEN2738: Protein of unknown function (DUF3833)	Pseudomonas fluorescens Pf-5 Gene: PFL_2260: Protein of unknown function (DUF3833)	Pseudomonas mendocina ymp Gene: Pmen_3103: Protein of unknown function (DUF3833)	Pseudomonas putida KT2440 Gene: PP2730: Protein of unknown function (DUF3833)	Pseudomonas stutzeri A1501	Pseudomonas syringae pv. tomato str. DC3000 Gene: PSPTO2515: Protein of unknown function (DUF3833)	Protein of unknown function (DUF3833)
phrB	Azotobacter vinelandii AvOP	Pseudomonas aeruginosa PAO1	Pseudomonas entomophila L48 Gene: PSEEN2739: DNA photolyase PhrB	Pseudomonas fluorescens Pf-5	Pseudomonas mendocina ymp	Pseudomonas putida KT2440 Gene: PP2732: DNA photolyase PhrB	Pseudomonas stutzeri A1501 Gene: PST_0952: DNA photolyase PhrB	* Pseudomonas syringae pv. tomato str. DC3000 Site: position = -47 score = 6.02411 sequence = TGTACAAAAATTTACATTGGTACA Gene: PSPTO3689: DNA photolyase PhrB	DNA photolyase PhrB
PSEEN2740	Azotobacter vinelandii AvOP	Pseudomonas aeruginosa PAO1	Pseudomonas entomophila L48 Gene: PSEEN2740: hypothetical protein	Pseudomonas fluorescens Pf-5	Pseudomonas mendocina ymp	Pseudomonas putida KT2440	Pseudomonas stutzeri A1501	Pseudomonas syringae pv. tomato str. DC3000	hypothetical protein
PP2511	Azotobacter vinelandii AvOP	Pseudomonas aeruginosa PAO1	Pseudomonas entomophila L48	Pseudomonas fluorescens Pf-5	Pseudomonas mendocina ymp	* Pseudomonas putida KT2440 Site: position = -35 score = 4.731 sequence = TATACAAAAACTTGTACAAGCATG Site: position = -23 score = 5.12281 sequence = TGTACAAGCATGAGAGGTTGTACA Gene: PP2511: Cell division inhibitor	Pseudomonas stutzeri A1501	Pseudomonas syringae pv. tomato str. DC3000	Cell division inhibitor
PF04134	Azotobacter vinelandii AvOP	Pseudomonas aeruginosa PAO1	Pseudomonas entomophila L48	Pseudomonas fluorescens Pf-5	Pseudomonas mendocina ymp	Pseudomonas putida KT2440 Gene: PP2731: Putative thiol-disulphide oxidoreductase DCC	* Pseudomonas stutzeri A1501 Site: position = -57 score = 5.16263 sequence = TGTACAGGATTATTGTTTTGTTCA Gene: PST_0951: Putative thiol-disulphide oxidoreductase DCC	Pseudomonas syringae pv. tomato str. DC3000	Putative thiol-disulphide oxidoreductase DCC

CRON 3.
mcp3	Azotobacter vinelandii AvOP	Pseudomonas aeruginosa PAO1	Pseudomonas entomophila L48	* Pseudomonas fluorescens Pf-5 Site: position = -134 score = 6.05663 sequence = TGTACATGAAACTTTTTTTGTACA Gene: PFL_2328: Methyl-accepting chemotaxis protein	Pseudomonas mendocina ymp	Pseudomonas putida KT2440	Pseudomonas stutzeri A1501	Pseudomonas syringae pv. tomato str. DC3000	Methyl-accepting chemotaxis protein

CRON 4.
mcp1	Azotobacter vinelandii AvOP	Pseudomonas aeruginosa PAO1	Pseudomonas entomophila L48	Pseudomonas fluorescens Pf-5	* Pseudomonas mendocina ymp Site: position = -94 score = 5.62994 sequence = TATACAAACAGGAATTCATGTACA Gene: Pmen_1353: Methyl-accepting chemotaxis protein	Pseudomonas putida KT2440	Pseudomonas stutzeri A1501 Gene: PST_0356: Methyl-accepting chemotaxis protein	Pseudomonas syringae pv. tomato str. DC3000 Gene: PSPTO3685: Methyl-accepting chemotaxis protein	Methyl-accepting chemotaxis protein

CRON 5.
COG3380	Azotobacter vinelandii AvOP Gene: Avin_41390: Predicted NAD/FAD-dependent oxidoreductase	* Pseudomonas aeruginosa PAO1 Site: position = -73 score = 5.94722 sequence = TGTACATTAAATCAAGCTTGTACA Gene: PA4657: Predicted NAD/FAD-dependent oxidoreductase	* Pseudomonas entomophila L48 Site: position = -74 score = 5.88813 sequence = TATACAAACATTGTGCATTGTACA Gene: PSEEN0884: Predicted NAD/FAD-dependent oxidoreductase	* Pseudomonas fluorescens Pf-5 Site: position = -71 score = 5.70407 sequence = TATACCAAAAAACAATATTGTACA Gene: PFL_5143: Predicted NAD/FAD-dependent oxidoreductase	* Pseudomonas mendocina ymp Site: position = -75 score = 5.87549 sequence = TGTACATGAAAACATTCTTGTATA Gene: Pmen_1075: Predicted NAD/FAD-dependent oxidoreductase	* Pseudomonas putida KT2440 Site: position = -74 score = 5.81396 sequence = TATACATAATTTTGGCATTGTACA Gene: PP0742: Predicted NAD/FAD-dependent oxidoreductase	Pseudomonas stutzeri A1501 Gene: PST_2515: Predicted NAD/FAD-dependent oxidoreductase	* Pseudomonas syringae pv. tomato str. DC3000 Site: position = -71 score = 5.43328 sequence = TATACCAAACAAGAAGATTGTACA Gene: PSPTO1126: Predicted NAD/FAD-dependent oxidoreductase	Predicted NAD/FAD-dependent oxidoreductase
PF09493	Azotobacter vinelandii AvOP	Pseudomonas aeruginosa PAO1	Pseudomonas entomophila L48	Pseudomonas fluorescens Pf-5 Gene: PFL_5144: Tryptophan-rich protein (DUF2389)	Pseudomonas mendocina ymp Gene: Pmen_1074: Tryptophan-rich protein (DUF2389)	Pseudomonas putida KT2440	Pseudomonas stutzeri A1501	Pseudomonas syringae pv. tomato str. DC3000 Gene: PSPTO1125: Tryptophan-rich protein (DUF2389)	Tryptophan-rich protein (DUF2389)

CRON 6.
COG3272	* Azotobacter vinelandii AvOP Site: position = -43 score = 4.97757 sequence = TATACAAATCATGAAAGCTGTACA Site: position = -94 score = 5.70596 sequence = TGTACAAACTGTTGATCATGTACA Gene: Avin_41400: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA	* Pseudomonas aeruginosa PAO1 Site: position = -106 score = 5.93001 sequence = TATACAAATACATTGACCTGTACA Gene: PA4658: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA	* Pseudomonas entomophila L48 Site: position = -43 score = 4.99184 sequence = TGTACAAACCAAGCCTTCTGTACA Site: position = -93 score = 5.55909 sequence = TATACAGAAAGTAACACTTGTATA Gene: PSEEN0883: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA	* Pseudomonas fluorescens Pf-5 Site: position = -97 score = 6.48806 sequence = TATACAAATAATTTGACTTGTACA Gene: PFL_5145: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA	* Pseudomonas mendocina ymp Site: position = -42 score = 5.15889 sequence = TGTACATGCACCAACATATGTACA Site: position = -92 score = 6.38811 sequence = TGTACAAATCATTTGACTTGTACA Gene: Pmen_1073: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA	* Pseudomonas putida KT2440 Site: position = -95 score = 5.62387 sequence = TATACAAAAATACTAGTTTGCATA Site: position = -45 score = 4.99403 sequence = TGTACAAGTTTCGAGTCACGTACA Gene: PP0741: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA	* Pseudomonas stutzeri A1501 Site: position = -217 score = 5.29583 sequence = TATACATGGTTATTCGAATGTACA Gene: PST_1966: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA	* Pseudomonas syringae pv. tomato str. DC3000 Site: position = -101 score = 6.12539 sequence = TCTACAAAGAATTTGACTTGTACA Site: position = -51 score = 4.88574 sequence = TGTACAGCACAGTTAATCTGTACA Gene: PSPTO1123: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA	COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA
phrR	Azotobacter vinelandii AvOP Gene: Avin_41410: Transcriptional regulator, MerR family, associated with photolyase	Pseudomonas aeruginosa PAO1 Gene: PA4659: Transcriptional regulator, MerR family, associated with photolyase	Pseudomonas entomophila L48 Gene: PSEEN0882: Transcriptional regulator, MerR family, associated with photolyase	Pseudomonas fluorescens Pf-5 Gene: PFL_5146: Transcriptional regulator, MerR family, associated with photolyase	Pseudomonas mendocina ymp Gene: Pmen_1072: Transcriptional regulator, MerR family, associated with photolyase	Pseudomonas putida KT2440 Gene: PP0740: Transcriptional regulator, MerR family, associated with photolyase	Pseudomonas stutzeri A1501 Gene: PST_1965: Transcriptional regulator, MerR family, associated with photolyase	Pseudomonas syringae pv. tomato str. DC3000 Gene: PSPTO1122: Transcriptional regulator, MerR family, associated with photolyase	Transcriptional regulator, MerR family, associated with photolyase
phr	Azotobacter vinelandii AvOP Gene: Avin_41430: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)	Pseudomonas aeruginosa PAO1 Gene: PA4660: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)	Pseudomonas entomophila L48 Gene: PSEEN0881: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)	Pseudomonas fluorescens Pf-5 Gene: PFL_5147: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)	Pseudomonas mendocina ymp Gene: Pmen_1071: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)	Pseudomonas putida KT2440 Gene: PP0739: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)	Pseudomonas stutzeri A1501 Gene: PST_1964: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)	Pseudomonas syringae pv. tomato str. DC3000 Gene: PSPTO1121: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)	Deoxyribodipyrimidine photolyase (EC 4.1.99.3)
PF07366	Azotobacter vinelandii AvOP	Pseudomonas aeruginosa PAO1	* Pseudomonas entomophila L48 Site: position = -94 score = 6.06155 sequence = TGTACAAGACTATTGACCTGTACA Site: position = -43 score = 4.64607 sequence = TGTACAAAATCACCTCGCTGTACA Gene: PSEEN2706: Protein of unknown function DUF1486	Pseudomonas fluorescens Pf-5 Gene: PFL_5148: Protein of unknown function DUF1486	Pseudomonas mendocina ymp Gene: Pmen_1070: Protein of unknown function DUF1486	* Pseudomonas putida KT2440 Site: position = -94 score = 6.08141 sequence = TATACAAGACCGTTGACTTGTATA Site: position = -43 score = 5.68758 sequence = TGTACAACAATTCAATTTTGTACA Gene: PP2738: Protein of unknown function DUF1486	Pseudomonas stutzeri A1501 Gene: PST_1963: Protein of unknown function DUF1486	Pseudomonas syringae pv. tomato str. DC3000 Gene: PSPTO1120: Protein of unknown function DUF1486	Protein of unknown function DUF1486
PF00106	Azotobacter vinelandii AvOP	Pseudomonas aeruginosa PAO1	2 Pseudomonas entomophila L48 Gene: PSEEN2705: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-) Gene: PSEEN0880: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)	Pseudomonas fluorescens Pf-5 Gene: PFL_5149: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)	Pseudomonas mendocina ymp Gene: Pmen_1069: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)	2 Pseudomonas putida KT2440 Gene: PP0738: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-) Gene: PP2737: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)	Pseudomonas stutzeri A1501 Gene: PST_1962: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)	Pseudomonas syringae pv. tomato str. DC3000 Gene: PSPTO1119: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)	Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)
PF01593	Azotobacter vinelandii AvOP	Pseudomonas aeruginosa PAO1	Pseudomonas entomophila L48 Gene: PSEEN2704: Flavin containing amine oxidoreductase	Pseudomonas fluorescens Pf-5 Gene: PFL_5150: Flavin containing amine oxidoreductase	Pseudomonas mendocina ymp Gene: Pmen_1068: Flavin containing amine oxidoreductase	Pseudomonas putida KT2440 Gene: PP2736: Flavin containing amine oxidoreductase	Pseudomonas stutzeri A1501 Gene: PST_1961: Flavin containing amine oxidoreductase	Pseudomonas syringae pv. tomato str. DC3000 Gene: PSPTO1118: Flavin containing amine oxidoreductase	Flavin containing amine oxidoreductase
PF07103	Azotobacter vinelandii AvOP	Pseudomonas aeruginosa PAO1	Pseudomonas entomophila L48 Gene: PSEEN2703: Protein of unknown function DUF1365	Pseudomonas fluorescens Pf-5 Gene: PFL_5151: Protein of unknown function DUF1365	Pseudomonas mendocina ymp Gene: Pmen_1067: Protein of unknown function DUF1365	Pseudomonas putida KT2440 Gene: PP2735: Protein of unknown function DUF1365	Pseudomonas stutzeri A1501 Gene: PST_1960: Protein of unknown function DUF1365	Pseudomonas syringae pv. tomato str. DC3000 Gene: PSPTO1117: Protein of unknown function DUF1365	Protein of unknown function DUF1365
PF02353	Azotobacter vinelandii AvOP	Pseudomonas aeruginosa PAO1	Pseudomonas entomophila L48 Gene: PSEEN2702: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase	Pseudomonas fluorescens Pf-5 Gene: PFL_5152: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase	Pseudomonas mendocina ymp Gene: Pmen_1066: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase	Pseudomonas putida KT2440 Gene: PP2734: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase	Pseudomonas stutzeri A1501 Gene: PST_1959: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase	Pseudomonas syringae pv. tomato str. DC3000 Gene: PSPTO1116: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase	S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase
PF11086	Azotobacter vinelandii AvOP	Pseudomonas aeruginosa PAO1	Pseudomonas entomophila L48 Gene: PSEEN2701: Protein of unknown function DUF2878	Pseudomonas fluorescens Pf-5 Gene: PFL_5153: Protein of unknown function DUF2878	Pseudomonas mendocina ymp Gene: Pmen_1065: Protein of unknown function DUF2878	Pseudomonas putida KT2440 Gene: PP2733: Protein of unknown function DUF2878	Pseudomonas stutzeri A1501	Pseudomonas syringae pv. tomato str. DC3000 Gene: PSPTO1115: Protein of unknown function DUF2878	Protein of unknown function DUF2878
mcp4	Azotobacter vinelandii AvOP	Pseudomonas aeruginosa PAO1	Pseudomonas entomophila L48	Pseudomonas fluorescens Pf-5	Pseudomonas mendocina ymp	Pseudomonas putida KT2440	Pseudomonas stutzeri A1501 Gene: PST_1958: methyl-accepting chemotaxis protein	Pseudomonas syringae pv. tomato str. DC3000 Gene: PSPTO0263: methyl-accepting chemotaxis protein	methyl-accepting chemotaxis protein

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog PhrR - Pseudomonadaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --