Regulog PhrR - Pseudomonadaceae
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | repressor |
| Biological process: | Light-dependent DNA repair |
| Effector: | Blue light; Adenosylcobalamin |
| Phylum: | Proteobacteria/Gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Pseudomonadaceae
- By trascription factor - PhrR
- By TF family - MerR
- By effector - Blue light
- By effector - Adenosylcobalamin
- By pathway - Light-dependent DNA repair
| Genome | Genes | Operons |
|---|---|---|
| Azotobacter vinelandii AvOP | 7 | 2 |
| Pseudomonas aeruginosa PAO1 | 4 | 2 |
| Pseudomonas entomophila L48 | 17 | 5 |
| Pseudomonas fluorescens Pf-5 | 17 | 5 |
| Pseudomonas mendocina ymp | 19 | 5 |
| Pseudomonas putida KT2440 | 15 | 5 |
| Pseudomonas stutzeri A1501 | 13 | 3 |
| Pseudomonas syringae pv. tomato str. DC3000 | 19 | 5 |
| Genes | Function | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||
| COG1090 |
Gene: Avin_41380: Predicted nucleoside-diphosphate sugar epimerase |
Gene: PA4656: Predicted nucleoside-diphosphate sugar epimerase |
*
Pseudomonas entomophila L48 Site: position = -137 score = 5.48454 sequence = TGTACAATGCACAATGTTTGTATA Gene: PSEEN0885: Predicted nucleoside-diphosphate sugar epimerase |
*
Pseudomonas fluorescens Pf-5 Site: position = -147 score = 5.57655 sequence = TGTACAATATTGTTTTTTGGTATA Gene: PFL_5142: Predicted nucleoside-diphosphate sugar epimerase |
*
Pseudomonas mendocina ymp Site: position = -131 score = 6.13282 sequence = TATACAAGAATGTTTTCATGTACA Gene: Pmen_1076: Predicted nucleoside-diphosphate sugar epimerase |
*
Pseudomonas putida KT2440 Site: position = -136 score = 5.30897 sequence = TGTACAATGCCAAAATTATGTATA Gene: PP0743: Predicted nucleoside-diphosphate sugar epimerase |
*
Pseudomonas stutzeri A1501 Site: position = -85 score = 5.21713 sequence = TGTACATTCGAATAACCATGTATA Gene: PST_1967: Predicted nucleoside-diphosphate sugar epimerase |
*
Pseudomonas syringae pv. tomato str. DC3000 Site: position = -240 score = 5.50449 sequence = TGTACAATCTTCTTGTTTGGTATA Gene: PSPTO1127: Predicted nucleoside-diphosphate sugar epimerase |
Predicted nucleoside-diphosphate sugar epimerase |
| hemH |
Gene: Avin_41370: Ferrochelatase, protoheme ferro-lyase (EC 4.99.1.1) |
Gene: PA4655: Ferrochelatase, protoheme ferro-lyase (EC 4.99.1.1) |
Gene: PSEEN0886: Ferrochelatase, protoheme ferro-lyase (EC 4.99.1.1) |
Gene: PFL_5141: Ferrochelatase, protoheme ferro-lyase (EC 4.99.1.1) |
Gene: Pmen_1077: Ferrochelatase, protoheme ferro-lyase (EC 4.99.1.1) |
Gene: PP0744: Ferrochelatase, protoheme ferro-lyase (EC 4.99.1.1) |
Gene: PST_1968: Ferrochelatase, protoheme ferro-lyase (EC 4.99.1.1) |
Gene: PSPTO1128: Ferrochelatase, protoheme ferro-lyase (EC 4.99.1.1) |
Ferrochelatase, protoheme ferro-lyase (EC 4.99.1.1) |
| CRON 2. | |||||||||
| folM |
*
Azotobacter vinelandii AvOP Site: position = -78 score = 4.40369 sequence = TGTACAAAGCGGGACACTGCTATA Gene: Avin_10270: FolM Alternative dihydrofolate reductase 1 |
Gene: PA3437: FolM Alternative dihydrofolate reductase 1 |
Gene: PSEEN4623: FolM Alternative dihydrofolate reductase 1 |
Gene: PFL_0950: FolM Alternative dihydrofolate reductase 1 |
*
Pseudomonas mendocina ymp Site: position = -251 score = 5.58199 sequence = TGTACAAAACACATGGATCGTACA Site: position = -118 score = 4.56068 sequence = TGTACAACCCGCAGCTCTGGTATA Gene: Pmen_3288: FolM Alternative dihydrofolate reductase 1 |
Gene: PP4632: FolM Alternative dihydrofolate reductase 1 |
Gene: PST_1136: FolM Alternative dihydrofolate reductase 1 |
*
Pseudomonas syringae pv. tomato str. DC3000 Site: position = -101 score = 6.0939 sequence = TGTACAAAAAAATTCTCTGGTATA Gene: PSPTO1183: FolM Alternative dihydrofolate reductase 1 |
FolM Alternative dihydrofolate reductase 1 |
| folE |
|
Gene: PA3438: GTP cyclohydrolase I (EC 3.5.4.16) type 1 |
|
*2
Pseudomonas fluorescens Pf-5 Gene: PFL_0949: GTP cyclohydrolase I (EC 3.5.4.16) type 1 Site: position = -229 score = 4.25293 sequence = TGTACAGATAAAAAGTATTGAATC Site: position = -190 score = 4.81819 sequence = TGTACAAGTATTTGGGCTTATAAG Site: position = -145 score = 4.3812 sequence = TGTACAAAAAATTAAATTGTCGTA Gene: PFL_2258: GTP cyclohydrolase I (EC 3.5.4.16) type 1 |
Gene: Pmen_3289: GTP cyclohydrolase I (EC 3.5.4.16) type 1 |
Gene: PP2512: GTP cyclohydrolase I (EC 3.5.4.16) type 1 |
|
Gene: PSPTO1182: GTP cyclohydrolase I (EC 3.5.4.16) type 1 |
GTP cyclohydrolase I (EC 3.5.4.16) type 1 |
| folB |
Gene: Avin_10260: Dihydroneopterin triphosphate epimerase |
Gene: PA3439: Dihydroneopterin triphosphate epimerase |
|
Gene: PFL_0948: Dihydroneopterin triphosphate epimerase |
Gene: Pmen_3290: Dihydroneopterin triphosphate epimerase |
|
Gene: PST_1135: Dihydroneopterin triphosphate epimerase |
Gene: PSPTO1181: Dihydroneopterin triphosphate epimerase |
Dihydroneopterin triphosphate epimerase |
| PF06844 |
Gene: Avin_10250: protein of unknown function DUF1244 |
Gene: PA3440: protein of unknown function DUF1244 |
Gene: PSEEN4624: protein of unknown function DUF1244 |
Gene: PFL_0947: protein of unknown function DUF1244 |
Gene: Pmen_3291: protein of unknown function DUF1244 |
Gene: PP4633: protein of unknown function DUF1244 |
Gene: PST_1134: protein of unknown function DUF1244 |
Gene: PSPTO1180: protein of unknown function DUF1244 |
protein of unknown function DUF1244 |
| PF08888 |
Gene: Avin_10240: HopJ type III effector protein |
|
Gene: PSEEN4625: HopJ type III effector protein |
Gene: PFL_0946: HopJ type III effector protein |
Gene: Pmen_3292: HopJ type III effector protein |
|
Gene: PST_1133: HopJ type III effector protein |
Gene: PSPTO1179: HopJ type III effector protein |
HopJ type III effector protein |
| PSEEN2737 |
|
|
*
Pseudomonas entomophila L48 Site: position = -49 score = 6.31376 sequence = TGTACAAGAACCTAGTCTTGTACA Gene: PSEEN2737: FIG026291: Hypothetical periplasmic protein |
Gene: PFL_2259: FIG026291: Hypothetical periplasmic protein |
Gene: Pmen_3102: FIG026291: Hypothetical periplasmic protein |
Gene: PP2729: FIG026291: Hypothetical periplasmic protein |
|
Gene: PSPTO2514: FIG026291: Hypothetical periplasmic protein |
FIG026291: Hypothetical periplasmic protein |
| PF12915 |
|
|
Gene: PSEEN2738: Protein of unknown function (DUF3833) |
Gene: PFL_2260: Protein of unknown function (DUF3833) |
Gene: Pmen_3103: Protein of unknown function (DUF3833) |
Gene: PP2730: Protein of unknown function (DUF3833) |
|
Gene: PSPTO2515: Protein of unknown function (DUF3833) |
Protein of unknown function (DUF3833) |
| phrB |
|
|
Gene: PSEEN2739: DNA photolyase PhrB |
|
|
Gene: PP2732: DNA photolyase PhrB |
Gene: PST_0952: DNA photolyase PhrB |
*
Pseudomonas syringae pv. tomato str. DC3000 Site: position = -47 score = 6.02411 sequence = TGTACAAAAATTTACATTGGTACA Gene: PSPTO3689: DNA photolyase PhrB |
DNA photolyase PhrB |
| PSEEN2740 |
|
|
Gene: PSEEN2740: hypothetical protein |
|
|
|
|
|
hypothetical protein |
| PP2511 |
|
|
|
|
|
*
Pseudomonas putida KT2440 Site: position = -35 score = 4.731 sequence = TATACAAAAACTTGTACAAGCATG Site: position = -23 score = 5.12281 sequence = TGTACAAGCATGAGAGGTTGTACA Gene: PP2511: Cell division inhibitor |
|
|
Cell division inhibitor |
| PF04134 |
|
|
|
|
|
Gene: PP2731: Putative thiol-disulphide oxidoreductase DCC |
*
Pseudomonas stutzeri A1501 Site: position = -57 score = 5.16263 sequence = TGTACAGGATTATTGTTTTGTTCA Gene: PST_0951: Putative thiol-disulphide oxidoreductase DCC |
|
Putative thiol-disulphide oxidoreductase DCC |
| CRON 3. | |||||||||
| mcp3 |
|
|
|
*
Pseudomonas fluorescens Pf-5 Site: position = -134 score = 6.05663 sequence = TGTACATGAAACTTTTTTTGTACA Gene: PFL_2328: Methyl-accepting chemotaxis protein |
|
|
|
|
Methyl-accepting chemotaxis protein |
| CRON 4. | |||||||||
| mcp1 |
|
|
|
|
*
Pseudomonas mendocina ymp Site: position = -94 score = 5.62994 sequence = TATACAAACAGGAATTCATGTACA Gene: Pmen_1353: Methyl-accepting chemotaxis protein |
|
Gene: PST_0356: Methyl-accepting chemotaxis protein |
Gene: PSPTO3685: Methyl-accepting chemotaxis protein |
Methyl-accepting chemotaxis protein |
| CRON 5. | |||||||||
| COG3380 |
Gene: Avin_41390: Predicted NAD/FAD-dependent oxidoreductase |
*
Pseudomonas aeruginosa PAO1 Site: position = -73 score = 5.94722 sequence = TGTACATTAAATCAAGCTTGTACA Gene: PA4657: Predicted NAD/FAD-dependent oxidoreductase |
*
Pseudomonas entomophila L48 Site: position = -74 score = 5.88813 sequence = TATACAAACATTGTGCATTGTACA Gene: PSEEN0884: Predicted NAD/FAD-dependent oxidoreductase |
*
Pseudomonas fluorescens Pf-5 Site: position = -71 score = 5.70407 sequence = TATACCAAAAAACAATATTGTACA Gene: PFL_5143: Predicted NAD/FAD-dependent oxidoreductase |
*
Pseudomonas mendocina ymp Site: position = -75 score = 5.87549 sequence = TGTACATGAAAACATTCTTGTATA Gene: Pmen_1075: Predicted NAD/FAD-dependent oxidoreductase |
*
Pseudomonas putida KT2440 Site: position = -74 score = 5.81396 sequence = TATACATAATTTTGGCATTGTACA Gene: PP0742: Predicted NAD/FAD-dependent oxidoreductase |
Gene: PST_2515: Predicted NAD/FAD-dependent oxidoreductase |
*
Pseudomonas syringae pv. tomato str. DC3000 Site: position = -71 score = 5.43328 sequence = TATACCAAACAAGAAGATTGTACA Gene: PSPTO1126: Predicted NAD/FAD-dependent oxidoreductase |
Predicted NAD/FAD-dependent oxidoreductase |
| PF09493 |
|
|
|
Gene: PFL_5144: Tryptophan-rich protein (DUF2389) |
Gene: Pmen_1074: Tryptophan-rich protein (DUF2389) |
|
|
Gene: PSPTO1125: Tryptophan-rich protein (DUF2389) |
Tryptophan-rich protein (DUF2389) |
| CRON 6. | |||||||||
| COG3272 |
*
Azotobacter vinelandii AvOP Site: position = -43 score = 4.97757 sequence = TATACAAATCATGAAAGCTGTACA Site: position = -94 score = 5.70596 sequence = TGTACAAACTGTTGATCATGTACA Gene: Avin_41400: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA |
*
Pseudomonas aeruginosa PAO1 Site: position = -106 score = 5.93001 sequence = TATACAAATACATTGACCTGTACA Gene: PA4658: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA |
*
Pseudomonas entomophila L48 Site: position = -43 score = 4.99184 sequence = TGTACAAACCAAGCCTTCTGTACA Site: position = -93 score = 5.55909 sequence = TATACAGAAAGTAACACTTGTATA Gene: PSEEN0883: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA |
*
Pseudomonas fluorescens Pf-5 Site: position = -97 score = 6.48806 sequence = TATACAAATAATTTGACTTGTACA Gene: PFL_5145: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA |
*
Pseudomonas mendocina ymp Site: position = -42 score = 5.15889 sequence = TGTACATGCACCAACATATGTACA Site: position = -92 score = 6.38811 sequence = TGTACAAATCATTTGACTTGTACA Gene: Pmen_1073: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA |
*
Pseudomonas putida KT2440 Site: position = -95 score = 5.62387 sequence = TATACAAAAATACTAGTTTGCATA Site: position = -45 score = 4.99403 sequence = TGTACAAGTTTCGAGTCACGTACA Gene: PP0741: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA |
*
Pseudomonas stutzeri A1501 Site: position = -217 score = 5.29583 sequence = TATACATGGTTATTCGAATGTACA Gene: PST_1966: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA |
*
Pseudomonas syringae pv. tomato str. DC3000 Site: position = -101 score = 6.12539 sequence = TCTACAAAGAATTTGACTTGTACA Site: position = -51 score = 4.88574 sequence = TGTACAGCACAGTTAATCTGTACA Gene: PSPTO1123: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA |
COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA |
| phrR |
Gene: Avin_41410: Transcriptional regulator, MerR family, associated with photolyase |
Gene: PA4659: Transcriptional regulator, MerR family, associated with photolyase |
Gene: PSEEN0882: Transcriptional regulator, MerR family, associated with photolyase |
Gene: PFL_5146: Transcriptional regulator, MerR family, associated with photolyase |
Gene: Pmen_1072: Transcriptional regulator, MerR family, associated with photolyase |
Gene: PP0740: Transcriptional regulator, MerR family, associated with photolyase |
Gene: PST_1965: Transcriptional regulator, MerR family, associated with photolyase |
Gene: PSPTO1122: Transcriptional regulator, MerR family, associated with photolyase |
Transcriptional regulator, MerR family, associated with photolyase |
| phr |
Gene: Avin_41430: Deoxyribodipyrimidine photolyase (EC 4.1.99.3) |
Gene: PA4660: Deoxyribodipyrimidine photolyase (EC 4.1.99.3) |
Gene: PSEEN0881: Deoxyribodipyrimidine photolyase (EC 4.1.99.3) |
Gene: PFL_5147: Deoxyribodipyrimidine photolyase (EC 4.1.99.3) |
Gene: Pmen_1071: Deoxyribodipyrimidine photolyase (EC 4.1.99.3) |
Gene: PP0739: Deoxyribodipyrimidine photolyase (EC 4.1.99.3) |
Gene: PST_1964: Deoxyribodipyrimidine photolyase (EC 4.1.99.3) |
Gene: PSPTO1121: Deoxyribodipyrimidine photolyase (EC 4.1.99.3) |
Deoxyribodipyrimidine photolyase (EC 4.1.99.3) |
| PF07366 |
|
|
*
Pseudomonas entomophila L48 Site: position = -94 score = 6.06155 sequence = TGTACAAGACTATTGACCTGTACA Site: position = -43 score = 4.64607 sequence = TGTACAAAATCACCTCGCTGTACA Gene: PSEEN2706: Protein of unknown function DUF1486 |
Gene: PFL_5148: Protein of unknown function DUF1486 |
Gene: Pmen_1070: Protein of unknown function DUF1486 |
*
Pseudomonas putida KT2440 Site: position = -94 score = 6.08141 sequence = TATACAAGACCGTTGACTTGTATA Site: position = -43 score = 5.68758 sequence = TGTACAACAATTCAATTTTGTACA Gene: PP2738: Protein of unknown function DUF1486 |
Gene: PST_1963: Protein of unknown function DUF1486 |
Gene: PSPTO1120: Protein of unknown function DUF1486 |
Protein of unknown function DUF1486 |
| PF00106 |
|
|
2
Pseudomonas entomophila L48 Gene: PSEEN2705: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-) Gene: PSEEN0880: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-) |
Gene: PFL_5149: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-) |
Gene: Pmen_1069: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-) |
2
Pseudomonas putida KT2440 Gene: PP0738: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-) Gene: PP2737: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-) |
Gene: PST_1962: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-) |
Gene: PSPTO1119: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-) |
Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-) |
| PF01593 |
|
|
Gene: PSEEN2704: Flavin containing amine oxidoreductase |
Gene: PFL_5150: Flavin containing amine oxidoreductase |
Gene: Pmen_1068: Flavin containing amine oxidoreductase |
Gene: PP2736: Flavin containing amine oxidoreductase |
Gene: PST_1961: Flavin containing amine oxidoreductase |
Gene: PSPTO1118: Flavin containing amine oxidoreductase |
Flavin containing amine oxidoreductase |
| PF07103 |
|
|
Gene: PSEEN2703: Protein of unknown function DUF1365 |
Gene: PFL_5151: Protein of unknown function DUF1365 |
Gene: Pmen_1067: Protein of unknown function DUF1365 |
Gene: PP2735: Protein of unknown function DUF1365 |
Gene: PST_1960: Protein of unknown function DUF1365 |
Gene: PSPTO1117: Protein of unknown function DUF1365 |
Protein of unknown function DUF1365 |
| PF02353 |
|
|
Gene: PSEEN2702: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase |
Gene: PFL_5152: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase |
Gene: Pmen_1066: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase |
Gene: PP2734: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase |
Gene: PST_1959: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase |
Gene: PSPTO1116: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase |
S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase |
| PF11086 |
|
|
Gene: PSEEN2701: Protein of unknown function DUF2878 |
Gene: PFL_5153: Protein of unknown function DUF2878 |
Gene: Pmen_1065: Protein of unknown function DUF2878 |
Gene: PP2733: Protein of unknown function DUF2878 |
|
Gene: PSPTO1115: Protein of unknown function DUF2878 |
Protein of unknown function DUF2878 |
| mcp4 |
|
|
|
|
|
|
Gene: PST_1958: methyl-accepting chemotaxis protein |
Gene: PSPTO0263: methyl-accepting chemotaxis protein |
methyl-accepting chemotaxis protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |