Regulon of PhrR in Pseudomonas aeruginosa PAO1

Properties
Regulator type:	Transcription factor
TF locus tag:	PA4659
Regulator family:	MerR
Regulation mode:	repressor
Biological process:	Light-dependent DNA repair
Effector:	Blue light; Adenosylcobalamin
Regulog:	PhrR - Pseudomonadaceae
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 43 sites [see more]

Member of regulog collections

By taxonomy - Pseudomonadaceae
By trascription factor - PhrR
By TF family - MerR
By effector - Blue light
By effector - Adenosylcobalamin
By pathway - Light-dependent DNA repair

Regulated operons
	Locus Tag	Name	Function
Position: -73 Score: 5.9 Sequence: TGTACATTAAATCAAGCTTGTACA Locus tag: PA4657 Name: COG3380 Funciton: Predicted NAD/FAD-dependent oxidoreductase
	PA4657	COG3380	Predicted NAD/FAD-dependent oxidoreductase
Position: -106 Score: 5.9 Sequence: TATACAAATACATTGACCTGTACA Locus tag: PA4658 Name: COG3272 Funciton: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA Locus tag: PA4659 Name: phrR Funciton: Transcriptional regulator, MerR family, associated with photolyase Locus tag: PA4660 Name: phr Funciton: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)
	PA4658	COG3272	COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA
	PA4659	phrR	Transcriptional regulator, MerR family, associated with photolyase
	PA4660	phr	Deoxyribodipyrimidine photolyase (EC 4.1.99.3)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD