Regulon of PhrR in Pseudomonas stutzeri A1501

Properties
Regulator type:	Transcription factor
TF locus tag:	PST_1965
Regulator family:	MerR
Regulation mode:	repressor
Biological process:	Light-dependent DNA repair
Effector:	Blue light; Adenosylcobalamin
Regulog:	PhrR - Pseudomonadaceae
Statistics of regulated genes:
- Genes	13
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 43 sites [see more]

Member of regulog collections

By taxonomy - Pseudomonadaceae
By trascription factor - PhrR
By TF family - MerR
By effector - Blue light
By effector - Adenosylcobalamin
By pathway - Light-dependent DNA repair

Regulated operons
	Locus Tag	Name	Function
Position: -85 Score: 5.2 Sequence: TGTACATTCGAATAACCATGTATA Locus tag: PST_1967 Name: COG1090 Funciton: Predicted nucleoside-diphosphate sugar epimerase Locus tag: PST_1968 Name: hemH Funciton: Ferrochelatase, protoheme ferro-lyase (EC 4.99.1.1)
	PST_1967	COG1090	Predicted nucleoside-diphosphate sugar epimerase
	PST_1968	hemH	Ferrochelatase, protoheme ferro-lyase (EC 4.99.1.1)
Position: -57 Score: 5.2 Sequence: TGTACAGGATTATTGTTTTGTTCA Locus tag: PST_0951 Name: PF04134 Funciton: Putative thiol-disulphide oxidoreductase DCC Locus tag: PST_0952 Name: phrB Funciton: DNA photolyase PhrB
	PST_0951	PF04134	Putative thiol-disulphide oxidoreductase DCC
	PST_0952	phrB	DNA photolyase PhrB
Position: -217 Score: 5.3 Sequence: TATACATGGTTATTCGAATGTACA Locus tag: PST_1966 Name: COG3272 Funciton: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA Locus tag: PST_1965 Name: phrR Funciton: Transcriptional regulator, MerR family, associated with photolyase Locus tag: PST_1964 Name: phr Funciton: Deoxyribodipyrimidine photolyase (EC 4.1.99.3) Locus tag: PST_1963 Name: PF07366 Funciton: Protein of unknown function DUF1486 Locus tag: PST_1962 Name: PF00106 Funciton: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-) Locus tag: PST_1961 Name: PF01593 Funciton: Flavin containing amine oxidoreductase Locus tag: PST_1960 Name: PF07103 Funciton: Protein of unknown function DUF1365 Locus tag: PST_1959 Name: PF02353 Funciton: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase Locus tag: PST_1958 Name: mcp4 Funciton: methyl-accepting chemotaxis protein
	PST_1966	COG3272	COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA
	PST_1965	phrR	Transcriptional regulator, MerR family, associated with photolyase
	PST_1964	phr	Deoxyribodipyrimidine photolyase (EC 4.1.99.3)
	PST_1963	PF07366	Protein of unknown function DUF1486
	PST_1962	PF00106	Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)
	PST_1961	PF01593	Flavin containing amine oxidoreductase
	PST_1960	PF07103	Protein of unknown function DUF1365
	PST_1959	PF02353	S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase
	PST_1958	mcp4	methyl-accepting chemotaxis protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD