Regulog Zur - Micrococcineae

Member of regulog collections
- By taxonomy - Micrococcineae
- By trascription factor - Zur
- By TF family - FUR
- By effector - Zinc ion, (Zn2+)
- By pathway - Zinc homeostasis
Genome | Genes | Operons |
---|---|---|
Arthrobacter aurescens TC1 | 7 | 4 |
Arthrobacter chlorophenolicus A6 | 8 | 3 |
Arthrobacter sp. FB24 | 6 | 3 |
Beutenbergia cavernae DSM 12333 | 5 | 2 |
Brachybacterium faecium DSM 4810 | 5 | 2 |
Brevibacterium linens BL2 | 7 | 5 |
Clavibacter michiganensis subsp. michiganensis NCPPB 382 | 11 | 5 |
Janibacter sp. HTCC2649 | 4 | 1 |
Jonesia denitrificans DSM 20603 | 5 | 2 |
Kocuria rhizophila DC2201 | 3 | 1 |
Kytococcus sedentarius DSM 20547 | 4 | 1 |
Leifsonia xyli subsp. xyli str. CTCB07 | 5 | 2 |
Renibacterium salmoninarum ATCC 33209 | 7 | 4 |
Tropheryma whipplei str. Twist |
Genes | Function | ||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
CRON 1. | |||||||||||||||
znuA |
*
Arthrobacter aurescens TC1 Site: position = -2 score = 4.2062 sequence = AATTGTGTTTGATTCTCATTT Gene: AAur_2632: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Arthrobacter chlorophenolicus A6 Site: position = -73 score = 4.73673 sequence = AAATAGGAATGATTCCCATTT Gene: Achl_2376: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Arthrobacter sp. FB24 Site: position = -98 score = 4.38296 sequence = AAATAGGAATGATTCCTATTT Site: position = -55 score = 4.45671 sequence = TAATGCTCCTGATTCTCATGT Gene: Arth_2641: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Beutenbergia cavernae DSM 12333 Site: position = -39 score = 4.63486 sequence = TTTTGACATCGGTTCTCATCT Gene: Bcav_1775: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Brachybacterium faecium DSM 4810 Site: position = -8 score = 4.83483 sequence = TGGTGAGAATGATTGTCATGT Gene: Bfae_17080: Zinc ABC transporter, periplasmic-binding protein ZnuA |
Gene: BlinB01001749: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Clavibacter michiganensis subsp. michiganensis NCPPB 382 Site: position = -37 score = 5.49082 sequence = TAGTGAGACTGGTTATCAATA Gene: CMM_2941: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Janibacter sp. HTCC2649 Site: position = -39 score = 5.04525 sequence = AGTTGACAATCATTCTCAACT Site: position = -17 score = 5.20393 sequence = AGTTGAGAATGATTGTCATGA Gene: JNB_04825: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Jonesia denitrificans DSM 20603 Site: position = -8 score = 5.49958 sequence = TATTGATAATGGATCTCATGA Gene: Jden_1533: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Kocuria rhizophila DC2201 Site: position = -100 score = 4.56222 sequence = AGATGAGAATGGTTAGTGATA Site: position = -63 score = 4.7101 sequence = TGATGACACTGATTCTCATCG Gene: KRH_09480: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Kytococcus sedentarius DSM 20547 Site: position = -17 score = 4.1794 sequence = ACCTGAGAATCATTGTCATGC Gene: Ksed_11830: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Leifsonia xyli subsp. xyli str. CTCB07 Site: position = -86 score = 5.41821 sequence = TTTTGACAATCATTATCAACA Gene: Lxx25040: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Renibacterium salmoninarum ATCC 33209 Site: position = -62 score = 4.41685 sequence = TGTTGCACATCATTCTCGATA Site: position = -103 score = 4.48063 sequence = TTATGCGAATGATTCCGATTA Gene: RSal33209_1398: Zinc ABC transporter, periplasmic-binding protein ZnuA |
|
Zinc ABC transporter, periplasmic-binding protein ZnuA |
znuC |
Gene: AAur_2631: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: Achl_2375: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: Arth_2640: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: Bcav_1774: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: Bfae_17090: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: BlinB01001750: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: CMM_2940: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: JNB_04830: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: Jden_1534: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: KRH_09490: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: Ksed_11820: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: Lxx25025: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: RSal33209_1399: Zinc ABC transporter, ATP-binding protein ZnuC |
|
Zinc ABC transporter, ATP-binding protein ZnuC |
znuB |
Gene: AAur_2629: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: Achl_2374: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: Arth_2639: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: Bcav_1773: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: Bfae_17100: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: BlinB01001751: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: CMM_2939: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: JNB_04835: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: Jden_1535: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: KRH_09500: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: Ksed_11810: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: Lxx25020: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: RSal33209_1400: Zinc ABC transporter, inner membrane permease protein ZnuB |
|
Zinc ABC transporter, inner membrane permease protein ZnuB |
zur |
Gene: AAur_2630: Zinc homeostasis transcriptional regulator Zur, Fur family |
Gene: Achl_2373: Zinc homeostasis transcriptional regulator Zur, Fur family |
Gene: Arth_2638: Zinc homeostasis transcriptional regulator Zur, Fur family |
Gene: Bcav_1772: Zinc homeostasis transcriptional regulator Zur, Fur family |
Gene: Bfae_17110: Zinc homeostasis transcriptional regulator Zur, Fur family |
*
Brevibacterium linens BL2 Site: position = -94 score = 5.00875 sequence = TAATGGTAACGTTTTTCATTA Gene: BlinB01002696: Zinc homeostasis transcriptional regulator Zur, Fur family |
Gene: CMM_2938: Zinc homeostasis transcriptional regulator Zur, Fur family |
Gene: JNB_04840: Zinc homeostasis transcriptional regulator Zur, Fur family |
Gene: Jden_1536: Zinc homeostasis transcriptional regulator Zur, Fur family |
Gene: KRH_09520: Zinc homeostasis transcriptional regulator Zur, Fur family |
Gene: Ksed_11800: Zinc homeostasis transcriptional regulator Zur, Fur family |
Gene: Lxx25010: Zinc homeostasis transcriptional regulator Zur, Fur family |
Gene: RSal33209_1401: Zinc homeostasis transcriptional regulator Zur, Fur family |
|
Zinc homeostasis transcriptional regulator Zur, Fur family |
CRON 2. | |||||||||||||||
RSal33209_0614 |
|
|
|
|
|
|
|
|
|
|
|
|
*
Renibacterium salmoninarum ATCC 33209 Site: position = -39 score = 5.72178 sequence = TAATGATCATGATGATCATTA Gene: RSal33209_0614: NADH-FMN oxidoreductase |
|
NADH-FMN oxidoreductase |
CRON 3. | |||||||||||||||
RSal33209_0615 |
|
|
|
|
|
|
|
|
|
|
|
|
*
Renibacterium salmoninarum ATCC 33209 Site: position = -109 score = 5.72178 sequence = TAATGATCATCATGATCATTA Gene: RSal33209_0615: transcriptional regulator, GntR family |
|
transcriptional regulator, GntR family |
CRON 4. | |||||||||||||||
znuB2 |
*
Arthrobacter aurescens TC1 Site: position = -2 score = 5.54117 sequence = TTTTGATAATGAATCTCAATA Gene: AAur_1962: Zinc ABC transporter, inner membrane permease protein ZnuB |
*
Arthrobacter chlorophenolicus A6 Site: position = -37 score = 5.82644 sequence = TGTTGATAATGATTCTTATTA Gene: Achl_2858: Zinc ABC transporter, inner membrane permease protein ZnuB |
|
|
|
*
Brevibacterium linens BL2 Site: position = -25 score = 5.45335 sequence = TAACAATAATGGTTATCATCA Gene: BlinB01002692: Zinc ABC transporter, inner membrane permease protein ZnuB |
*
Clavibacter michiganensis subsp. michiganensis NCPPB 382 Site: position = -40 score = 4.99115 sequence = AGTTGATAAGCATTCTCATTC Gene: CMM_0175: Zinc ABC transporter, inner membrane permease protein ZnuB |
|
|
|
|
|
|
|
Zinc ABC transporter, inner membrane permease protein ZnuB |
COG1520 |
Gene: AAur_1963: WD40/YVTN repeat-like-containing domain |
Gene: Achl_2857: WD40/YVTN repeat-like-containing domain |
|
|
|
*
Brevibacterium linens BL2 Site: position = -31 score = 5.85923 sequence = CAATGAGAACCATTATCAATA Gene: BlinB01002691: WD40/YVTN repeat-like-containing domain |
Gene: CMM_0176: WD40/YVTN repeat-like-containing domain |
|
|
|
|
|
|
|
WD40/YVTN repeat-like-containing domain |
znuA2 |
Gene: AAur_1964: Zinc ABC transporter, periplasmic-binding protein ZnuA |
Gene: Achl_2856: Zinc ABC transporter, periplasmic-binding protein ZnuA |
|
|
|
Gene: BlinB01002690: Zinc ABC transporter, periplasmic-binding protein ZnuA |
Gene: CMM_0177: Zinc ABC transporter, periplasmic-binding protein ZnuA |
|
|
|
|
|
Gene: RSal33209_3501: Zinc ABC transporter, periplasmic-binding protein ZnuA |
|
Zinc ABC transporter, periplasmic-binding protein ZnuA |
AAur_1965 |
Gene: AAur_1965: WD40/YVTN repeat-like-containing domain |
Gene: Achl_2855: WD40/YVTN repeat-like-containing domain |
*
Arthrobacter sp. FB24 Site: position = -26 score = 5.77057 sequence = TAATGAGAATGACTATCATTT Gene: Arth_4108: WD40/YVTN repeat-like-containing domain |
*
Beutenbergia cavernae DSM 12333 Site: position = -68 score = 5.08085 sequence = GAATGAGAATGACTCTCGTTA Gene: Bcav_0090: WD40/YVTN repeat-like-containing domain |
*
Brachybacterium faecium DSM 4810 Site: position = -62 score = 4.96513 sequence = AGATGCGAACGATTATCAGTA Site: position = -17 score = 5.38419 sequence = TGATGAGAACGGTTTTCATGA Gene: Bfae_30770: WD40/YVTN repeat-like-containing domain |
Gene: BlinB01002689: WD40/YVTN repeat-like-containing domain |
Gene: CMM_0178: WD40/YVTN repeat-like-containing domain |
|
*
Jonesia denitrificans DSM 20603 Site: position = -30 score = 5.54463 sequence = TATTGATAATCGTTCCCAGTA Gene: Jden_1380: WD40/YVTN repeat-like-containing domain |
2
Kocuria rhizophila DC2201 Gene: KRH_00830: WD40/YVTN repeat-like-containing domain Gene: KRH_00820: WD40/YVTN repeat-like-containing domain |
|
|
Gene: RSal33209_3218: WD40/YVTN repeat-like-containing domain |
|
WD40/YVTN repeat-like-containing domain |
CRON 5. | |||||||||||||||
znuC2 |
*
Arthrobacter aurescens TC1 Site: position = 23 score = 5.54117 sequence = TATTGAGATTCATTATCAAAA Gene: AAur_1961: Zinc ABC transporter, ATP-binding protein ZnuC |
*
Arthrobacter chlorophenolicus A6 Site: position = -31 score = 5.82644 sequence = TAATAAGAATCATTATCAACA Gene: Achl_2859: Zinc ABC transporter, ATP-binding protein ZnuC |
|
|
|
*
Brevibacterium linens BL2 Site: position = -25 score = 5.45335 sequence = TGATGATAACCATTATTGTTA Gene: BlinB01002693: Zinc ABC transporter, ATP-binding protein ZnuC |
|
|
|
|
|
|
|
|
Zinc ABC transporter, ATP-binding protein ZnuC |
CRON 6. | |||||||||||||||
yciC |
*
Arthrobacter aurescens TC1 Site: position = -118 score = 6.00054 sequence = TATTGAGAATGCTTCTCAATA Gene: AAur_2880: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family |
|
*
Arthrobacter sp. FB24 Site: position = -2 score = 5.6669 sequence = AAATGAGAATGATTCTCATAT Gene: Arth_3252: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family |
|
|
|
|
|
|
|
|
|
*
Renibacterium salmoninarum ATCC 33209 Site: position = -33 score = 5.01537 sequence = AAATGAGAATCATTCGCATGT Gene: RSal33209_1680: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family |
|
Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family |
rpmJ2 |
Gene: AAur_2879: LSU ribosomal protein L36p |
|
Gene: Arth_3254: LSU ribosomal protein L36p |
|
|
|
*
Clavibacter michiganensis subsp. michiganensis NCPPB 382 Site: position = -34 score = 5.60127 sequence = TATTGAGAACCGTTCTCGTGA Gene: CMM_0025: LSU ribosomal protein L36p |
|
Gene: Jden_0071: LSU ribosomal protein L36p |
Gene: KRH_23160: LSU ribosomal protein L36p |
|
*
Leifsonia xyli subsp. xyli str. CTCB07 Site: position = -34 score = 5.56 sequence = TAATGATAATCTTTCTCAGTA Gene: Lxx20595: LSU ribosomal protein L36p |
Gene: RSal33209_1679: LSU ribosomal protein L36p |
|
LSU ribosomal protein L36p |
CRON 7. | |||||||||||||||
yciC2 |
|
|
|
|
|
*
Brevibacterium linens BL2 Site: position = -56 score = 5.55453 sequence = TATTGAGAACGAGTATTATTA Gene: BlinB01002697: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family |
*2
Clavibacter michiganensis subsp. michiganensis NCPPB 382 Site: position = -32 score = 4.82981 sequence = AGATGAGAACGGTTCTCTTCT Gene: CMM_0314: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family Site: position = -31 score = 5.60127 sequence = TCACGAGAACGGTTCTCAATA Gene: CMM_0026: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family |
|
|
Gene: KRH_17280: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family |
|
|
|
|
Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
![]() |
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
![]() |
Regulatory Sites | [ FASTA format ] | DOWNLOAD |