Regulon of Zur in Renibacterium salmoninarum ATCC 33209

Properties
Regulator type:	Transcription factor
TF locus tag:	RSal33209_1401
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Micrococcineae
Statistics of regulated genes:
- Genes	7
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 40 sites [see more]

Member of regulog collections

By taxonomy - Micrococcineae
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -33 Score: 5 Sequence: AAATGAGAATCATTCGCATGT Locus tag: RSal33209_1680 Name: yciC Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family Locus tag: RSal33209_1679 Name: rpmJ2 Funciton: LSU ribosomal protein L36p
	RSal33209_1680	yciC	Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
	RSal33209_1679	rpmJ2	LSU ribosomal protein L36p
Position: -39 Score: 5.7 Sequence: TAATGATCATGATGATCATTA Locus tag: RSal33209_0614 Name: null Funciton: NADH-FMN oxidoreductase
	RSal33209_0614		NADH-FMN oxidoreductase
Position: -109 Score: 5.7 Sequence: TAATGATCATCATGATCATTA Locus tag: RSal33209_0615 Name: null Funciton: transcriptional regulator, GntR family
	RSal33209_0615		transcriptional regulator, GntR family
Position: -103 Score: 4.5 Sequence: TTATGCGAATGATTCCGATTA Position: -62 Score: 4.4 Sequence: TGTTGCACATCATTCTCGATA Locus tag: RSal33209_1398 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: RSal33209_1399 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: RSal33209_1400 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	RSal33209_1398	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
	RSal33209_1399	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	RSal33209_1400	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD