Regulon of Zur in Leifsonia xyli subsp. xyli str. CTCB07

Properties
Regulator type:	Transcription factor
TF locus tag:	Lxx25010
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Micrococcineae
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 40 sites [see more]

Member of regulog collections

By taxonomy - Micrococcineae
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -34 Score: 5.6 Sequence: TAATGATAATCTTTCTCAGTA Locus tag: Lxx20595 Name: rpmJ2 Funciton: LSU ribosomal protein L36p
	Lxx20595	rpmJ2	LSU ribosomal protein L36p
Position: -86 Score: 5.4 Sequence: TTTTGACAATCATTATCAACA Locus tag: Lxx25040 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: Lxx25025 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: Lxx25020 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: Lxx25010 Name: zur Funciton: Zinc homeostasis transcriptional regulator Zur, Fur family
	Lxx25040	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
	Lxx25025	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	Lxx25020	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
	Lxx25010	zur	Zinc homeostasis transcriptional regulator Zur, Fur family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD