Regulon of Zur in Brachybacterium faecium DSM 4810

Properties
Regulator type:	Transcription factor
TF locus tag:	Bfae_17110
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Micrococcineae
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 40 sites [see more]

Member of regulog collections

By taxonomy - Micrococcineae
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -8 Score: 4.8 Sequence: TGGTGAGAATGATTGTCATGT Locus tag: Bfae_17080 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: Bfae_17090 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: Bfae_17100 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: Bfae_17110 Name: zur Funciton: Zinc homeostasis transcriptional regulator Zur, Fur family
	Bfae_17080	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
	Bfae_17090	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	Bfae_17100	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
	Bfae_17110	zur	Zinc homeostasis transcriptional regulator Zur, Fur family
Position: -62 Score: 5 Sequence: AGATGCGAACGATTATCAGTA Position: -17 Score: 5.4 Sequence: TGATGAGAACGGTTTTCATGA Locus tag: Bfae_30770 Name: AAur_1965 Funciton: WD40/YVTN repeat-like-containing domain
	Bfae_30770	AAur_1965	WD40/YVTN repeat-like-containing domain

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD