Regulon of Zur in Arthrobacter sp. FB24

Properties
Regulator type:	Transcription factor
TF locus tag:	Arth_2638
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Micrococcineae
Statistics of regulated genes:
- Genes	6
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 40 sites [see more]

Member of regulog collections

By taxonomy - Micrococcineae
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -2 Score: 5.7 Sequence: AAATGAGAATGATTCTCATAT Locus tag: Arth_3252 Name: yciC Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family Locus tag: Arth_3254 Name: rpmJ2 Funciton: LSU ribosomal protein L36p
	Arth_3252	yciC	Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
	Arth_3254	rpmJ2	LSU ribosomal protein L36p
Position: -98 Score: 4.4 Sequence: AAATAGGAATGATTCCTATTT Position: -55 Score: 4.5 Sequence: TAATGCTCCTGATTCTCATGT Locus tag: Arth_2641 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: Arth_2640 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: Arth_2639 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	Arth_2641	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
	Arth_2640	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	Arth_2639	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
Position: -26 Score: 5.8 Sequence: TAATGAGAATGACTATCATTT Locus tag: Arth_4108 Name: AAur_1965 Funciton: WD40/YVTN repeat-like-containing domain
	Arth_4108	AAur_1965	WD40/YVTN repeat-like-containing domain

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD