Regulon of Zur in Arthrobacter chlorophenolicus A6

Properties
Regulator type:	Transcription factor
TF locus tag:	Achl_2373
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Micrococcineae
Statistics of regulated genes:
- Genes	8
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 40 sites [see more]

Member of regulog collections

By taxonomy - Micrococcineae
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -37 Score: 5.8 Sequence: TGTTGATAATGATTCTTATTA Locus tag: Achl_2858 Name: znuB2 Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: Achl_2857 Name: COG1520 Funciton: WD40/YVTN repeat-like-containing domain Locus tag: Achl_2856 Name: znuA2 Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: Achl_2855 Name: AAur_1965 Funciton: WD40/YVTN repeat-like-containing domain
	Achl_2858	znuB2	Zinc ABC transporter, inner membrane permease protein ZnuB
	Achl_2857	COG1520	WD40/YVTN repeat-like-containing domain
	Achl_2856	znuA2	Zinc ABC transporter, periplasmic-binding protein ZnuA
	Achl_2855	AAur_1965	WD40/YVTN repeat-like-containing domain
Position: -73 Score: 4.7 Sequence: AAATAGGAATGATTCCCATTT Locus tag: Achl_2376 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: Achl_2375 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: Achl_2374 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	Achl_2376	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
	Achl_2375	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	Achl_2374	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
Position: -31 Score: 5.8 Sequence: TAATAAGAATCATTATCAACA Locus tag: Achl_2859 Name: znuC2 Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
	Achl_2859	znuC2	Zinc ABC transporter, ATP-binding protein ZnuC

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD