Regulon of Zur in Beutenbergia cavernae DSM 12333

Properties
Regulator type:	Transcription factor
TF locus tag:	Bcav_1772
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Micrococcineae
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 40 sites [see more]

Member of regulog collections

By taxonomy - Micrococcineae
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -39 Score: 4.6 Sequence: TTTTGACATCGGTTCTCATCT Locus tag: Bcav_1775 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: Bcav_1774 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: Bcav_1773 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: Bcav_1772 Name: zur Funciton: Zinc homeostasis transcriptional regulator Zur, Fur family
	Bcav_1775	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
	Bcav_1774	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	Bcav_1773	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
	Bcav_1772	zur	Zinc homeostasis transcriptional regulator Zur, Fur family
Position: -68 Score: 5.1 Sequence: GAATGAGAATGACTCTCGTTA Locus tag: Bcav_0090 Name: AAur_1965 Funciton: WD40/YVTN repeat-like-containing domain
	Bcav_0090	AAur_1965	WD40/YVTN repeat-like-containing domain

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD