Regulon of Zur in Arthrobacter aurescens TC1

Properties
Regulator type:	Transcription factor
TF locus tag:	AAur_2630
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Micrococcineae
Statistics of regulated genes:
- Genes	7
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 40 sites [see more]

Member of regulog collections

By taxonomy - Micrococcineae
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -118 Score: 6 Sequence: TATTGAGAATGCTTCTCAATA Locus tag: AAur_2880 Name: yciC Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family Locus tag: AAur_2879 Name: rpmJ2 Funciton: LSU ribosomal protein L36p
	AAur_2880	yciC	Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
	AAur_2879	rpmJ2	LSU ribosomal protein L36p
Position: -2 Score: 5.5 Sequence: TTTTGATAATGAATCTCAATA Locus tag: AAur_1962 Name: znuB2 Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	AAur_1962	znuB2	Zinc ABC transporter, inner membrane permease protein ZnuB
Position: -2 Score: 4.2 Sequence: AATTGTGTTTGATTCTCATTT Locus tag: AAur_2632 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: AAur_2631 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: AAur_2629 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	AAur_2632	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
	AAur_2631	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	AAur_2629	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
Position: 23 Score: 5.5 Sequence: TATTGAGATTCATTATCAAAA Locus tag: AAur_1961 Name: znuC2 Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
	AAur_1961	znuC2	Zinc ABC transporter, ATP-binding protein ZnuC

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD