Regulon of Zur in Clavibacter michiganensis subsp. michiganensis NCPPB 382

Properties
Regulator type:	Transcription factor
TF locus tag:	CMM_2938
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Micrococcineae
Statistics of regulated genes:
- Genes	11
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 40 sites [see more]

Member of regulog collections

By taxonomy - Micrococcineae
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -37 Score: 5.5 Sequence: TAGTGAGACTGGTTATCAATA Locus tag: CMM_2941 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: CMM_2940 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: CMM_2939 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: CMM_2938 Name: zur Funciton: Zinc homeostasis transcriptional regulator Zur, Fur family
	CMM_2941	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
	CMM_2940	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	CMM_2939	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
	CMM_2938	zur	Zinc homeostasis transcriptional regulator Zur, Fur family
Position: -40 Score: 5 Sequence: AGTTGATAAGCATTCTCATTC Locus tag: CMM_0175 Name: znuB2 Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: CMM_0176 Name: COG1520 Funciton: WD40/YVTN repeat-like-containing domain Locus tag: CMM_0177 Name: znuA2 Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: CMM_0178 Name: AAur_1965 Funciton: WD40/YVTN repeat-like-containing domain
	CMM_0175	znuB2	Zinc ABC transporter, inner membrane permease protein ZnuB
	CMM_0176	COG1520	WD40/YVTN repeat-like-containing domain
	CMM_0177	znuA2	Zinc ABC transporter, periplasmic-binding protein ZnuA
	CMM_0178	AAur_1965	WD40/YVTN repeat-like-containing domain
Position: -34 Score: 5.6 Sequence: TATTGAGAACCGTTCTCGTGA Locus tag: CMM_0025 Name: rpmJ2 Funciton: LSU ribosomal protein L36p
	CMM_0025	rpmJ2	LSU ribosomal protein L36p
Position: -32 Score: 4.8 Sequence: AGATGAGAACGGTTCTCTTCT Locus tag: CMM_0314 Name: yciC2 Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
	CMM_0314	yciC2	Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
Position: -31 Score: 5.6 Sequence: TCACGAGAACGGTTCTCAATA Locus tag: CMM_0026 Name: yciC2 Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
	CMM_0026	yciC2	Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD