Regulon of Zur in Kocuria rhizophila DC2201

Properties
Regulator type:	Transcription factor
TF locus tag:	KRH_09520
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Micrococcineae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 40 sites [see more]

Member of regulog collections

By taxonomy - Micrococcineae
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -100 Score: 4.6 Sequence: AGATGAGAATGGTTAGTGATA Position: -63 Score: 4.7 Sequence: TGATGACACTGATTCTCATCG Locus tag: KRH_09480 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: KRH_09490 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: KRH_09500 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	KRH_09480	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
	KRH_09490	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	KRH_09500	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD