Regulog Crp - Bacteroidaceae
| Regulator type: | Transcription factor |
| Regulator family: | CRP |
| Regulation mode: | activator |
| Biological process: | |
| Effector: | |
| Phylum: | Bacteroidetes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bacteroidaceae
- By TF family - CRP
| Genome | Genes | Operons |
|---|---|---|
| Bacteroides cellulosilyticus DSM 14838 | 31 | 11 |
| Bacteroides coprophilus DSM 18228 | 3 | 3 |
| Bacteroides dorei DSM 17855 | 24 | 10 |
| Bacteroides eggerthii DSM 20697 | 26 | 11 |
| Bacteroides fragilis NCTC 9343 | 26 | 11 |
| Bacteroides ovatus ATCC 8483 | 31 | 11 |
| Bacteroides plebeius DSM 17135 | 13 | 4 |
| Bacteroides stercoris ATCC 43183 | 15 | 9 |
| Bacteroides thetaiotaomicron VPI-5482 | 39 | 13 |
| Bacteroides uniformis ATCC 8492 | 30 | 12 |
| Bacteroides vulgatus ATCC 8482 | 24 | 10 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| xylR |
*
Bacteroides cellulosilyticus DSM 14838 Site: position = -83 score = 4.8625 sequence = AATAGTGCTTTATAACATAATA Gene: BACCELL_04758: Predicted regulator of xylose utilization, NrtR family |
|
*
Bacteroides dorei DSM 17855 Site: position = -34 score = 4.79014 sequence = AATAGTGTTTTAGAACATAATA Gene: BACDOR_00865: Predicted regulator of xylose utilization, NrtR family |
*
Bacteroides eggerthii DSM 20697 Site: position = -92 score = 4.77237 sequence = AATAATGCTTTGTAACATATCA Gene: BACEGG_02642: Predicted regulator of xylose utilization, NrtR family |
*
Bacteroides fragilis NCTC 9343 Site: position = -81 score = 4.56893 sequence = AACAATGCTTTATAGCATATTA Gene: BF2354: Predicted regulator of xylose utilization, NrtR family |
*
Bacteroides ovatus ATCC 8483 Site: position = -80 score = 4.20374 sequence = AACAATGTTTTATAGCATGTTT Gene: BACOVA_02532: Predicted regulator of xylose utilization, NrtR family |
Gene: BACPLE_02263: Predicted regulator of xylose utilization, NrtR family |
*
Bacteroides stercoris ATCC 43183 Site: position = -92 score = 4.27792 sequence = AATAATGCTTTATAACATTGTA Gene: BACSTE_01380: Predicted regulator of xylose utilization, NrtR family |
*
Bacteroides thetaiotaomicron VPI-5482 Site: position = -81 score = 4.23108 sequence = AACAATGTTTTATAGCATGTCA Gene: BT0791: Predicted regulator of xylose utilization, NrtR family |
*
Bacteroides uniformis ATCC 8492 Site: position = -92 score = 4.09714 sequence = AATAATGCTTTATAATATTATA Gene: BACUNI_00695: Predicted regulator of xylose utilization, NrtR family |
*
Bacteroides vulgatus ATCC 8482 Site: position = -100 score = 4.54006 sequence = AATAGTGTTTTGGAACATAATA Gene: BVU_3955: Predicted regulator of xylose utilization, NrtR family |
Predicted regulator of xylose utilization, NrtR family |
| xylB |
Gene: BACCELL_04759: Xylulose kinase (EC 2.7.1.17) |
|
Gene: BACDOR_00866: Xylulose kinase (EC 2.7.1.17) |
Gene: BACEGG_02643: Xylulose kinase (EC 2.7.1.17) |
Gene: BF2355: Xylulose kinase (EC 2.7.1.17) |
Gene: BACOVA_02533: Xylulose kinase (EC 2.7.1.17) |
Gene: BACPLE_02264: Xylulose kinase (EC 2.7.1.17) |
Gene: BACSTE_01381: Xylulose kinase (EC 2.7.1.17) |
Gene: BT0792: Xylulose kinase (EC 2.7.1.17) |
Gene: BACUNI_00694: Xylulose kinase (EC 2.7.1.17) |
Gene: BVU_3954: Xylulose kinase (EC 2.7.1.17) |
Xylulose kinase (EC 2.7.1.17) |
| xylA |
Gene: BACCELL_04760: Xylose isomerase (EC 5.3.1.5) |
|
Gene: BACDOR_00867: Xylose isomerase (EC 5.3.1.5) |
Gene: BACEGG_02644: Xylose isomerase (EC 5.3.1.5) |
Gene: BF2356: Xylose isomerase (EC 5.3.1.5) |
Gene: BACOVA_02534: Xylose isomerase (EC 5.3.1.5) |
Gene: BACPLE_02265: Xylose isomerase (EC 5.3.1.5) |
Gene: BACSTE_01383: Xylose isomerase (EC 5.3.1.5) |
Gene: BT0793: Xylose isomerase (EC 5.3.1.5) |
Gene: BACUNI_00693: Xylose isomerase (EC 5.3.1.5) |
Gene: BVU_3953: Xylose isomerase (EC 5.3.1.5) |
Xylose isomerase (EC 5.3.1.5) |
| xylE |
Gene: BACCELL_04761: D-xylose proton-symporter XylE |
|
Gene: BACDOR_00759: D-xylose proton-symporter XylE |
Gene: BACEGG_02645: D-xylose proton-symporter XylE |
Gene: BF2357: D-xylose proton-symporter XylE |
Gene: BACOVA_02535: D-xylose proton-symporter XylE |
Gene: BACPLE_02266: D-xylose proton-symporter XylE |
Gene: BACSTE_01384: D-xylose proton-symporter XylE |
Gene: BT0794: D-xylose proton-symporter XylE |
Gene: BACUNI_00692: D-xylose proton-symporter XylE |
Gene: BVU_4073: D-xylose proton-symporter XylE |
D-xylose proton-symporter XylE |
| CRON 2. | ||||||||||||
| nupG |
Gene: BACCELL_03457: Nucleoside permease NupG |
Gene: BACCOPRO_00774: Nucleoside permease NupG |
Gene: BACDOR_01556: Nucleoside permease NupG |
*
Bacteroides eggerthii DSM 20697 Site: position = -193 score = 5.82074 sequence = GACTATGTTATATAACATAAAA Gene: BACEGG_01333: Nucleoside permease NupG |
Gene: BF0944: Nucleoside permease NupG |
*
Bacteroides ovatus ATCC 8483 Site: position = -269 score = 5.63672 sequence = CATTATGTTGTATAACATAAAC Gene: BACOVA_05132: Nucleoside permease NupG |
Gene: BACPLE_01143: Nucleoside permease NupG |
*
Bacteroides stercoris ATCC 43183 Site: position = -230 score = 5.67212 sequence = CATTATGTTTTATAACATAAAT Gene: BACSTE_03522: Nucleoside permease NupG |
*
Bacteroides thetaiotaomicron VPI-5482 Site: position = -271 score = 5.73915 sequence = CATTATGTTCTATAACATAAAA Gene: BT4330: Nucleoside permease NupG |
*
Bacteroides uniformis ATCC 8492 Site: position = -245 score = 5.03377 sequence = CAGCATGTTATATAACATAAAC Gene: BACUNI_01546: Nucleoside permease NupG |
Gene: BVU_3613: Nucleoside permease NupG |
Nucleoside permease NupG |
| CRON 3. | ||||||||||||
| serB |
*
Bacteroides cellulosilyticus DSM 14838 Site: position = -163 score = 5.4883 sequence = TTTCATGTTATATAACATGTTT Gene: BACCELL_04825: Phosphoserine phosphatase (EC 3.1.3.3) |
*
Bacteroides coprophilus DSM 18228 Site: position = -134 score = 5.5879 sequence = AATTATGCTTTTAAACATAAAT Gene: BACCOPRO_01694: Phosphoserine phosphatase (EC 3.1.3.3) |
*
Bacteroides dorei DSM 17855 Site: position = -116 score = 6.05616 sequence = AAATATGTTATATAGCATAAAA Gene: BACDOR_02848: Phosphoserine phosphatase (EC 3.1.3.3) |
*
Bacteroides eggerthii DSM 20697 Site: position = -74 score = 6.34032 sequence = TTTTATGTTATTTAGCATAAAA Gene: BACEGG_02676: Phosphoserine phosphatase (EC 3.1.3.3) |
*
Bacteroides fragilis NCTC 9343 Site: position = -71 score = 6.18331 sequence = TTTTATGTTATTTAGCATAAAT Gene: BF2389: Phosphoserine phosphatase (EC 3.1.3.3) |
*
Bacteroides ovatus ATCC 8483 Site: position = -66 score = 6.34032 sequence = TTTTATGTTATTTAGCATAAAA Gene: BACOVA_02567: Phosphoserine phosphatase (EC 3.1.3.3) |
Gene: BACPLE_00754: Phosphoserine phosphatase (EC 3.1.3.3) |
*
Bacteroides stercoris ATCC 43183 Site: position = -74 score = 6.34032 sequence = TTTTATGTTATTTAGCATAAAA Gene: BACSTE_01424: Phosphoserine phosphatase (EC 3.1.3.3) |
*
Bacteroides thetaiotaomicron VPI-5482 Site: position = -67 score = 6.34032 sequence = TTTTATGTTATTTAGCATAAAA Gene: BT0832: Phosphoserine phosphatase (EC 3.1.3.3) |
*
Bacteroides uniformis ATCC 8492 Site: position = -75 score = 6.18331 sequence = TTTTATGTTATTTAGCATAAAT Gene: BACUNI_00649: Phosphoserine phosphatase (EC 3.1.3.3) |
*
Bacteroides vulgatus ATCC 8482 Site: position = -116 score = 6.05616 sequence = AAATATGTTATATAGCATAAAA Gene: BVU_3158: Phosphoserine phosphatase (EC 3.1.3.3) |
Phosphoserine phosphatase (EC 3.1.3.3) |
| CRON 4. | ||||||||||||
| PF01694 |
*
Bacteroides cellulosilyticus DSM 14838 Site: position = -196 score = 5.03588 sequence = TAATATGTTACACAAAAGATAT Site: position = -62 score = 5.79697 sequence = TTTTCTGTTATAGAACAGAATT Gene: BACCELL_02471: Peptidase S54, rhomboid domain |
Gene: BACCOPRO_00242: Peptidase S54, rhomboid domain |
*
Bacteroides dorei DSM 17855 Site: position = -71 score = 6.17781 sequence = TTTTCTGTTATATAACAGAATA Gene: BACDOR_01705: Peptidase S54, rhomboid domain |
*
Bacteroides eggerthii DSM 20697 Site: position = -188 score = 5.34989 sequence = TAATATGTTACACAAAAGAAAA Site: position = -61 score = 5.79697 sequence = TTTTCTGTTATAGAACAGAATT Gene: BACEGG_03101: Peptidase S54, rhomboid domain |
*
Bacteroides fragilis NCTC 9343 Site: position = -227 score = 5.04957 sequence = ATATATGTTACACAAAAGATAT Site: position = -105 score = 5.73991 sequence = TTTTCTGTTGTAGAACAGAATT Gene: BF4221: Peptidase S54, rhomboid domain |
*
Bacteroides ovatus ATCC 8483 Site: position = -195 score = 5.03588 sequence = ATATATGTTACACAAAAGATTA Site: position = -66 score = 5.41387 sequence = TTTCATGCTTTAAAACAGAATT Gene: BACOVA_02079: Peptidase S54, rhomboid domain |
Gene: BACPLE_00187: Peptidase S54, rhomboid domain |
*
Bacteroides stercoris ATCC 43183 Site: position = -188 score = 4.34752 sequence = TTAATTGTTACACAAAAGAAAA Site: position = -61 score = 5.79697 sequence = TTTTCTGTTATAGAACAGAATT Gene: BACSTE_02140: Peptidase S54, rhomboid domain |
*
Bacteroides thetaiotaomicron VPI-5482 Site: position = -192 score = 4.87887 sequence = ATATATGTTACACAAAAGATTT Site: position = -69 score = 4.98217 sequence = TTCCATGCTTTAAAACAGAATT Gene: BT2831: Peptidase S54, rhomboid domain |
*
Bacteroides uniformis ATCC 8492 Site: position = -230 score = 5.03588 sequence = TAATATGTTACACAAAAGATAT Site: position = -97 score = 5.79697 sequence = TTTTCTGTTATAGAACAGAATT Gene: BACUNI_03999: Peptidase S54, rhomboid domain |
*
Bacteroides vulgatus ATCC 8482 Site: position = -71 score = 6.17781 sequence = TTTTCTGTTATATAACAGAATA Gene: BVU_0995: Peptidase S54, rhomboid domain |
Peptidase S54, rhomboid domain |
| PF01694 |
Gene: BACCELL_02470: Peptidase S54, rhomboid domain |
Gene: BACCOPRO_00243: Peptidase S54, rhomboid domain |
Gene: BACDOR_01704: Peptidase S54, rhomboid domain |
Gene: BACEGG_03102: Peptidase S54, rhomboid domain |
Gene: BF4222: Peptidase S54, rhomboid domain |
Gene: BACOVA_02080: Peptidase S54, rhomboid domain |
Gene: BACPLE_00186: Peptidase S54, rhomboid domain |
Gene: BACSTE_02141: Peptidase S54, rhomboid domain |
Gene: BT2832: Peptidase S54, rhomboid domain |
Gene: BACUNI_04000: Peptidase S54, rhomboid domain |
Gene: BVU_0994: Peptidase S54, rhomboid domain |
Peptidase S54, rhomboid domain |
| PF03372 |
Gene: BACCELL_02469: Endonuclease/exonuclease/phosphatase |
Gene: BACCOPRO_00244: Endonuclease/exonuclease/phosphatase |
Gene: BACDOR_01703: Endonuclease/exonuclease/phosphatase |
Gene: BACEGG_03103: Endonuclease/exonuclease/phosphatase |
Gene: BF4223: Endonuclease/exonuclease/phosphatase |
Gene: BACOVA_02081: Endonuclease/exonuclease/phosphatase |
|
Gene: BACSTE_02142: Endonuclease/exonuclease/phosphatase |
Gene: BT2833: Endonuclease/exonuclease/phosphatase |
Gene: BACUNI_04001: Endonuclease/exonuclease/phosphatase |
Gene: BVU_0993: Endonuclease/exonuclease/phosphatase |
Endonuclease/exonuclease/phosphatase |
| PF01432 |
Gene: BACCELL_02468: Peptidase M3A/M3B, thimet/oligopeptidase F |
Gene: BACCOPRO_00245: Peptidase M3A/M3B, thimet/oligopeptidase F |
Gene: BACDOR_01702: Peptidase M3A/M3B, thimet/oligopeptidase F |
Gene: BACEGG_03104: Peptidase M3A/M3B, thimet/oligopeptidase F |
|
Gene: BACOVA_02082: Peptidase M3A/M3B, thimet/oligopeptidase F |
Gene: BACPLE_00184: Peptidase M3A/M3B, thimet/oligopeptidase F |
Gene: BACSTE_02143: Peptidase M3A/M3B, thimet/oligopeptidase F |
Gene: BT2834: Peptidase M3A/M3B, thimet/oligopeptidase F |
Gene: BACUNI_04002: Peptidase M3A/M3B, thimet/oligopeptidase F |
Gene: BVU_0992: Peptidase M3A/M3B, thimet/oligopeptidase F |
Peptidase M3A/M3B, thimet/oligopeptidase F |
| secDF |
Gene: BACCELL_02467: Preprotein translocase subunits SecD-SecF |
Gene: BACCOPRO_00246: Preprotein translocase subunits SecD-SecF |
Gene: BACDOR_01701: Preprotein translocase subunits SecD-SecF |
Gene: BACEGG_03105: Preprotein translocase subunits SecD-SecF |
Gene: BF4225: Preprotein translocase subunits SecD-SecF |
Gene: BACOVA_02083: Preprotein translocase subunits SecD-SecF |
Gene: BACPLE_00183: Preprotein translocase subunits SecD-SecF |
Gene: BACSTE_02144: Preprotein translocase subunits SecD-SecF |
Gene: BT2835: Preprotein translocase subunits SecD-SecF |
Gene: BACUNI_04003: Preprotein translocase subunits SecD-SecF |
Gene: BVU_0991: Preprotein translocase subunits SecD-SecF |
Preprotein translocase subunits SecD-SecF |
| CRON 5. | ||||||||||||
| BACCELL_00794 |
*
Bacteroides cellulosilyticus DSM 14838 Site: position = -135 score = 6.07378 sequence = TTTTATGTTATAAAACATATTT Gene: BACCELL_00794: hypothetical protein |
Gene: BACCOPRO_00747: hypothetical protein |
*
Bacteroides dorei DSM 17855 Site: position = -33 score = 4.53713 sequence = TTTTAGGTTTAACAAATTAAAA Gene: BACDOR_04003: hypothetical protein |
*
Bacteroides eggerthii DSM 20697 Site: position = -129 score = 5.51497 sequence = TTTTGTGTTATAAAACATATTC Gene: BACEGG_00156: hypothetical protein |
*
Bacteroides fragilis NCTC 9343 Site: position = -151 score = 5.95002 sequence = TTTTATGTTGAATAACATATTT Gene: BF3646: hypothetical protein |
*
Bacteroides ovatus ATCC 8483 Site: position = -135 score = 5.81011 sequence = TTTTATGCTATAAAACATATTC Gene: BACOVA_03166: hypothetical protein |
*
Bacteroides plebeius DSM 17135 Site: position = -116 score = 5.47314 sequence = TTTTATGTTATCCAACATATTC Gene: BACPLE_00736: hypothetical protein |
*
Bacteroides stercoris ATCC 43183 Site: position = -132 score = 5.67198 sequence = TTTTGTGTTATAAAACATAATC Gene: BACSTE_03638: hypothetical protein |
*
Bacteroides thetaiotaomicron VPI-5482 Site: position = -135 score = 5.39099 sequence = TTTTATGCTATAAAACATATCG Gene: BT2178: hypothetical protein |
*
Bacteroides uniformis ATCC 8492 Site: position = -125 score = 5.68567 sequence = TTTTGTGTTATAAAACATATAC Gene: BACUNI_03316: hypothetical protein |
*
Bacteroides vulgatus ATCC 8482 Site: position = -33 score = 4.53713 sequence = TTTTAGGTTTAACAAATTAAAA Gene: BVU_2553: hypothetical protein |
hypothetical protein |
| CRON 6. | ||||||||||||
| pflB |
*
Bacteroides cellulosilyticus DSM 14838 Site: position = -107 score = 6.04252 sequence = TTTTATGTCGTACAACATAAAA Gene: BACCELL_03929: Pyruvate formate-lyase (EC 2.3.1.54) |
Gene: BACCOPRO_00555: Pyruvate formate-lyase (EC 2.3.1.54) |
Gene: BACDOR_04432: Pyruvate formate-lyase (EC 2.3.1.54) |
*
Bacteroides eggerthii DSM 20697 Site: position = -4 score = 6.05942 sequence = TTTTATGTTCTTCAGCATAAAA Gene: BACEGG_01611: Pyruvate formate-lyase (EC 2.3.1.54) |
*
Bacteroides fragilis NCTC 9343 Site: position = -107 score = 6.28325 sequence = TTTTATGCTATTCAACATAAAA Gene: BF1323: Pyruvate formate-lyase (EC 2.3.1.54) |
*
Bacteroides ovatus ATCC 8483 Site: position = -113 score = 6.14939 sequence = TTTTATGTTGAAAAGCATAAAA Gene: BACOVA_05597: Pyruvate formate-lyase (EC 2.3.1.54) |
Gene: BACPLE_01859: Pyruvate formate-lyase (EC 2.3.1.54) |
*
Bacteroides stercoris ATCC 43183 Site: position = -116 score = 6.05942 sequence = TTTTATGCTCTTCAACATAAAA Gene: BACSTE_00806: Pyruvate formate-lyase (EC 2.3.1.54) |
*
Bacteroides thetaiotaomicron VPI-5482 Site: position = -114 score = 6.14939 sequence = TTTTATGTTGAAAAGCATAAAA Gene: BT4738: Pyruvate formate-lyase (EC 2.3.1.54) |
*
Bacteroides uniformis ATCC 8492 Site: position = -117 score = 6.22618 sequence = TTTTATGCTGTTCAACATAAAA Gene: BACUNI_04526: Pyruvate formate-lyase (EC 2.3.1.54) |
Gene: BVU_2880: Pyruvate formate-lyase (EC 2.3.1.54) |
Pyruvate formate-lyase (EC 2.3.1.54) |
| pflA |
Gene: BACCELL_03928: Pyruvate formate-lyase activating enzyme (EC 1.97.1.4) |
Gene: BACCOPRO_00554: Pyruvate formate-lyase activating enzyme (EC 1.97.1.4) |
Gene: BACDOR_04431: Pyruvate formate-lyase activating enzyme (EC 1.97.1.4) |
Gene: BACEGG_01610: Pyruvate formate-lyase activating enzyme (EC 1.97.1.4) |
Gene: BF1322: Pyruvate formate-lyase activating enzyme (EC 1.97.1.4) |
Gene: BACOVA_05596: Pyruvate formate-lyase activating enzyme (EC 1.97.1.4) |
Gene: BACPLE_01858: Pyruvate formate-lyase activating enzyme (EC 1.97.1.4) |
Gene: BACSTE_00807: Pyruvate formate-lyase activating enzyme (EC 1.97.1.4) |
Gene: BT4737: Pyruvate formate-lyase activating enzyme (EC 1.97.1.4) |
Gene: BACUNI_04527: Pyruvate formate-lyase activating enzyme (EC 1.97.1.4) |
Gene: BVU_2879: Pyruvate formate-lyase activating enzyme (EC 1.97.1.4) |
Pyruvate formate-lyase activating enzyme (EC 1.97.1.4) |
| CRON 7. | ||||||||||||
| PF09719 |
*
Bacteroides cellulosilyticus DSM 14838 Site: position = -142 score = 5.58512 sequence = TTTTATGACATATAACATAAAA Site: position = -110 score = 5.76102 sequence = TAATGTGTTATATAACATAAAT Gene: BACCELL_04404: Putative redox-active protein (C_GCAxxG_C_C) |
Gene: BACCOPRO_00412: Putative redox-active protein (C_GCAxxG_C_C) |
*
Bacteroides dorei DSM 17855 Site: position = -110 score = 4.5762 sequence = AAAAGTGTTGAATAACATAATT Gene: BACDOR_00927: Putative redox-active protein (C_GCAxxG_C_C) |
*
Bacteroides eggerthii DSM 20697 Site: position = -109 score = 5.55836 sequence = TAACGTGTTATATAACATAAAA Gene: BACEGG_02494: Putative redox-active protein (C_GCAxxG_C_C) |
*
Bacteroides fragilis NCTC 9343 Site: position = -99 score = 5.86502 sequence = TAATCTGTTATATAACATAATT Gene: BF2582: Putative redox-active protein (C_GCAxxG_C_C) |
*
Bacteroides ovatus ATCC 8483 Site: position = -107 score = 5.31853 sequence = TAAAGTGTTATATAACATAAAA Gene: BACOVA_02257: Putative redox-active protein (C_GCAxxG_C_C) |
Gene: BACPLE_02921: Putative redox-active protein (C_GCAxxG_C_C) |
*
Bacteroides stercoris ATCC 43183 Site: position = -110 score = 5.40688 sequence = TAACGTGCTATATAACATAAAA Gene: BACSTE_01186: Putative redox-active protein (C_GCAxxG_C_C) |
|
*
Bacteroides uniformis ATCC 8492 Site: position = -105 score = 5.34429 sequence = TAACGTGTTGTATAACATAAAT Gene: BACUNI_02281: Putative redox-active protein (C_GCAxxG_C_C) |
*
Bacteroides vulgatus ATCC 8482 Site: position = -104 score = 4.5762 sequence = AAAAGTGTTGAATAACATAATT Gene: BVU_3908: Putative redox-active protein (C_GCAxxG_C_C) |
Putative redox-active protein (C_GCAxxG_C_C) |
| CRON 8. | ||||||||||||
| fucR |
*
Bacteroides cellulosilyticus DSM 14838 Site: position = -124 score = 5.2163 sequence = TTATATGCTGCAAAACATATCC Gene: BACCELL_04988: Transcriptional regulator of fucose utilization, GntR family |
|
*
Bacteroides dorei DSM 17855 Site: position = -114 score = 5.14649 sequence = TCTTGTGTTATAAAACATACCA Gene: BACDOR_02265: Transcriptional regulator of fucose utilization, GntR family |
|
*
Bacteroides fragilis NCTC 9343 Site: position = -114 score = 5.59933 sequence = TTTGATGTTGTATAACATACCA Gene: BF0210: Transcriptional regulator of fucose utilization, GntR family |
*
Bacteroides ovatus ATCC 8483 Site: position = -100 score = 5.77773 sequence = TTTTCTGCTATAAAACATATCA Gene: BACOVA_03849: Transcriptional regulator of fucose utilization, GntR family |
*
Bacteroides plebeius DSM 17135 Site: position = -93 score = 4.58841 sequence = AAATCTGTTCTTAAACATAGCT Gene: BACPLE_02898: Transcriptional regulator of fucose utilization, GntR family |
|
*
Bacteroides thetaiotaomicron VPI-5482 Site: position = -100 score = 5.45775 sequence = TTTCCTGCTATAGAACATATTA Gene: BT1272: Transcriptional regulator of fucose utilization, GntR family |
|
*
Bacteroides vulgatus ATCC 8482 Site: position = -114 score = 4.98948 sequence = TCTTGTGTTATAAAACATACCT Gene: BVU_1374: Transcriptional regulator of fucose utilization, GntR family |
Transcriptional regulator of fucose utilization, GntR family |
| fucI |
2
Bacteroides cellulosilyticus DSM 14838 Gene: BACCELL_04986: L-fucose isomerase (EC 5.3.1.25) Gene: BACCELL_04985: L-fucose isomerase (EC 5.3.1.25) |
Gene: BACCOPRO_03383: L-fucose isomerase (EC 5.3.1.25) |
Gene: BACDOR_02264: L-fucose isomerase (EC 5.3.1.25) |
|
Gene: BF0211: L-fucose isomerase (EC 5.3.1.25) |
Gene: BACOVA_03850: L-fucose isomerase (EC 5.3.1.25) |
Gene: BACPLE_02897: L-fucose isomerase (EC 5.3.1.25) |
|
Gene: BT1273: L-fucose isomerase (EC 5.3.1.25) |
|
Gene: BVU_1373: L-fucose isomerase (EC 5.3.1.25) |
L-fucose isomerase (EC 5.3.1.25) |
| fucA |
Gene: BACCELL_04984: L-fuculose phosphate aldolase (EC 4.1.2.17) |
Gene: BACCOPRO_03381: L-fuculose phosphate aldolase (EC 4.1.2.17) |
|
|
Gene: BF0213: L-fuculose phosphate aldolase (EC 4.1.2.17) |
Gene: BACOVA_03851: L-fuculose phosphate aldolase (EC 4.1.2.17) |
Gene: BACPLE_02896: L-fuculose phosphate aldolase (EC 4.1.2.17) |
|
Gene: BT1274: L-fuculose phosphate aldolase (EC 4.1.2.17) |
|
|
L-fuculose phosphate aldolase (EC 4.1.2.17) |
| fucK |
Gene: BACCELL_04983: L-fuculokinase (EC 2.7.1.51) |
Gene: BACCOPRO_03380: L-fuculokinase (EC 2.7.1.51) |
|
|
Gene: BF0214: L-fuculokinase (EC 2.7.1.51) |
Gene: BACOVA_03852: L-fuculokinase (EC 2.7.1.51) |
Gene: BACPLE_02895: L-fuculokinase (EC 2.7.1.51) |
|
Gene: BT1275: L-fuculokinase (EC 2.7.1.51) |
|
|
L-fuculokinase (EC 2.7.1.51) |
| fucU |
Gene: BACCELL_04982: Possible alternative L-fucose mutarotase |
|
|
|
|
Gene: BACOVA_03853: Possible alternative L-fucose mutarotase |
|
|
Gene: BT1276: Possible alternative L-fucose mutarotase |
|
|
Possible alternative L-fucose mutarotase |
| fucP |
Gene: BACCELL_04981: L-fucose permease |
Gene: BACCOPRO_03379: L-fucose permease |
Gene: BACDOR_02263: L-fucose permease |
|
Gene: BF0215: L-fucose permease |
Gene: BACOVA_03854: L-fucose permease |
Gene: BACPLE_02894: L-fucose permease |
|
Gene: BT1277: L-fucose permease |
|
Gene: BVU_1372: L-fucose permease |
L-fucose permease |
| fucO |
|
Gene: BACCOPRO_03382: Lactaldehyde reductase (EC 1.1.1.77) |
|
|
Gene: BF0212: Lactaldehyde reductase (EC 1.1.1.77) |
|
|
|
|
|
|
Lactaldehyde reductase (EC 1.1.1.77) |
| CRON 9. | ||||||||||||
| PF10438 |
|
*
Bacteroides coprophilus DSM 18228 Site: position = -53 score = 5.45147 sequence = TAATATGTTGGAAAACATATAA Gene: BACCOPRO_03681: Cyclo-malto-dextrinase C-terminal domain, involved in stabilisation of acitve sites |
*
Bacteroides dorei DSM 17855 Site: position = -58 score = 5.37802 sequence = AGATATGCTGAAAAACATATAA Gene: BACDOR_03939: Cyclo-malto-dextrinase C-terminal domain, involved in stabilisation of acitve sites |
|
|
|
Gene: BACPLE_02836: Cyclo-malto-dextrinase C-terminal domain, involved in stabilisation of acitve sites |
|
|
|
*
Bacteroides vulgatus ATCC 8482 Site: position = -58 score = 5.37802 sequence = AGATATGCTGAAAAACATATAA Gene: BVU_2487: Cyclo-malto-dextrinase C-terminal domain, involved in stabilisation of acitve sites |
Cyclo-malto-dextrinase C-terminal domain, involved in stabilisation of acitve sites |
| CRON 10. | ||||||||||||
| susC_Rgu-1 |
*
Bacteroides cellulosilyticus DSM 14838 Site: position = -184 score = 5.75749 sequence = TTTTCTGTTATATAACATCATT Gene: BACCELL_03135: TonB-dependent outer membrane transporter of rhamnogalacturonan oligomers |
|
|
*
Bacteroides eggerthii DSM 20697 Site: position = -185 score = 5.28078 sequence = ATTTCTGCTTTACAACATACTC Gene: BACEGG_00870: TonB-dependent outer membrane transporter of rhamnogalacturonan oligomers |
|
|
|
|
Gene: BT4114: TonB-dependent outer membrane transporter of rhamnogalacturonan oligomers |
|
|
TonB-dependent outer membrane transporter of rhamnogalacturonan oligomers |
| susD_Rgu-1 |
Gene: BACCELL_03134: Outer membrane polysaccharide binding protein for rhamnogalacturonan oligomers |
|
|
Gene: BACEGG_00869: Outer membrane polysaccharide binding protein for rhamnogalacturonan oligomers |
|
|
|
|
Gene: BT4113: Outer membrane polysaccharide binding protein for rhamnogalacturonan oligomers |
|
|
Outer membrane polysaccharide binding protein for rhamnogalacturonan oligomers |
| BT4112 |
Gene: BACCELL_03133: Predicted pectin lyase |
|
|
Gene: BACEGG_00868: Predicted pectin lyase |
|
|
|
|
Gene: BT4112: Predicted pectin lyase |
|
|
Predicted pectin lyase |
| CRON 11. | ||||||||||||
| BT1272 |
|
|
|
|
*
Bacteroides fragilis NCTC 9343 Site: position = -90 score = 5.71151 sequence = TATTATGTTACAAAACATATAC Gene: BF0315: Transcriptional regulator, GntR family |
|
|
|
*
Bacteroides thetaiotaomicron VPI-5482 Site: position = -77 score = 4.76959 sequence = CTGTATGTTGTAAAACACATAC Gene: BT2096: Transcriptional regulator, GntR family |
|
|
Transcriptional regulator, GntR family |
| CRON 12. | ||||||||||||
| xylD |
Gene: BACCELL_00858: Endo-1,4-beta-xylanase D |
|
Gene: BACDOR_01276: Endo-1,4-beta-xylanase D |
|
|
|
Gene: BACPLE_03732: Endo-1,4-beta-xylanase D |
|
Gene: BT3675: Endo-1,4-beta-xylanase D |
*
Bacteroides uniformis ATCC 8492 Site: position = -91 score = 5.53279 sequence = GTATATGTTACACAACATATAC Gene: BACUNI_03327: Endo-1,4-beta-xylanase D |
Gene: BVU_0497: Endo-1,4-beta-xylanase D |
Endo-1,4-beta-xylanase D |
| GH97 |
Gene: BACCELL_00859: Alpha-glucosidase, glycoside hydrolase family 97 |
|
Gene: BACDOR_01718: Alpha-glucosidase, glycoside hydrolase family 97 |
*
Bacteroides eggerthii DSM 20697 Site: position = -92 score = 5.17313 sequence = GTATATGTTACACAACATGTAC Gene: BACEGG_00165: Alpha-glucosidase, glycoside hydrolase family 97 |
|
Gene: BACOVA_03484: Alpha-glucosidase, glycoside hydrolase family 97 |
|
|
Gene: BT3661: Alpha-glucosidase, glycoside hydrolase family 97 |
Gene: BACUNI_03328: Alpha-glucosidase, glycoside hydrolase family 97 |
Gene: BVU_1004: Alpha-glucosidase, glycoside hydrolase family 97 |
Alpha-glucosidase, glycoside hydrolase family 97 |
| CRON 13. | ||||||||||||
| susC_Crp-4 |
|
|
Gene: BACDOR_03230: TonB-dependent outer membrane transporter of oligosaccharides |
|
*
Bacteroides fragilis NCTC 9343 Site: position = -162 score = 5.39054 sequence = TTCTATGTTATTAGACATAAAA Gene: BF0594: TonB-dependent outer membrane transporter of oligosaccharides |
|
|
*
Bacteroides stercoris ATCC 43183 Site: position = -162 score = 5.28741 sequence = AAACATGCTATTCAGCATAAAA Gene: BACSTE_00464: TonB-dependent outer membrane transporter of oligosaccharides |
|
|
|
TonB-dependent outer membrane transporter of oligosaccharides |
| susD_Crp-4 |
|
|
Gene: BACDOR_03231: Outer membrane polysaccharide binding protein for oligosaccharides |
|
Gene: BF0595: Outer membrane polysaccharide binding protein for oligosaccharides |
|
|
Gene: BACSTE_00462: Outer membrane polysaccharide binding protein for oligosaccharides |
|
|
|
Outer membrane polysaccharide binding protein for oligosaccharides |
| CRON 14. | ||||||||||||
| susC_Crp-3 |
*
Bacteroides cellulosilyticus DSM 14838 Site: position = -225 score = 5.37678 sequence = TTCTATGTTCTATAACATGCAA Gene: BACCELL_03480: TonB-dependent outer membrane transporter of oligosaccharides |
|
|
|
|
|
|
|
|
*
Bacteroides uniformis ATCC 8492 Site: position = -225 score = 4.9997 sequence = TTTTGTGTTATATAACATGTTG Gene: BACUNI_01489: TonB-dependent outer membrane transporter of oligosaccharides |
|
TonB-dependent outer membrane transporter of oligosaccharides |
| susD_Crp-3 |
Gene: BACCELL_03481: Outer membrane polysaccharide binding protein for oligosaccharides |
|
|
|
|
|
|
|
|
Gene: BACUNI_01488: Outer membrane polysaccharide binding protein for oligosaccharides |
|
Outer membrane polysaccharide binding protein for oligosaccharides |
| BACCELL_03482 |
Gene: BACCELL_03482: Galactose-binding domain-like |
|
|
|
|
|
|
|
|
Gene: BACUNI_01487: Galactose-binding domain-like |
|
Galactose-binding domain-like |
| PF00722 |
Gene: BACCELL_03483: Glycoside hydrolase, family 16 |
|
|
|
|
|
Gene: BACPLE_03793: Glycoside hydrolase, family 16 |
|
|
*
Bacteroides uniformis ATCC 8492 Site: position = -26 score = 5.05324 sequence = ACTTATGTTGTAAAATATATAT Gene: BACUNI_01486: Glycoside hydrolase, family 16 |
|
Glycoside hydrolase, family 16 |
| PF00933 |
Gene: BACCELL_03484: Glycoside hydrolase, family 3 |
|
|
|
|
|
Gene: BACPLE_03792: Glycoside hydrolase, family 3 |
|
|
Gene: BACUNI_01484: Glycoside hydrolase, family 3 |
|
Glycoside hydrolase, family 3 |
| PF02836 |
|
|
|
|
|
|
|
|
|
Gene: BACUNI_01485: Glycoside hydrolase, family 2 |
|
Glycoside hydrolase, family 2 |
| CRON 15. | ||||||||||||
| uxuR |
|
|
|
|
|
*
Bacteroides ovatus ATCC 8483 Site: position = -162 score = 5.26252 sequence = TCTTATGTTTAACAACATGTAT Gene: BACOVA_00860: Predicted transcriptional regulator for glucuronate catabolism, LacI family |
Gene: BACPLE_03706: Predicted transcriptional regulator for glucuronate catabolism, LacI family |
|
*
Bacteroides thetaiotaomicron VPI-5482 Site: position = -207 score = 5.11416 sequence = TCTTATGTTTAACAACATACGT Gene: BT1434: Predicted transcriptional regulator for glucuronate catabolism, LacI family |
|
|
Predicted transcriptional regulator for glucuronate catabolism, LacI family |
| uxuB |
Gene: BACCELL_01659: D-mannonate oxidoreductase (EC 1.1.1.57) |
|
Gene: BACDOR_02114: D-mannonate oxidoreductase (EC 1.1.1.57) |
Gene: BACEGG_03381: D-mannonate oxidoreductase (EC 1.1.1.57) |
Gene: BF0143: D-mannonate oxidoreductase (EC 1.1.1.57) |
Gene: BACOVA_00859: D-mannonate oxidoreductase (EC 1.1.1.57) |
Gene: BACPLE_03707: D-mannonate oxidoreductase (EC 1.1.1.57) |
Gene: BACSTE_02444: D-mannonate oxidoreductase (EC 1.1.1.57) |
Gene: BT1433: D-mannonate oxidoreductase (EC 1.1.1.57) |
Gene: BACUNI_01039: D-mannonate oxidoreductase (EC 1.1.1.57) |
Gene: BVU_1261: D-mannonate oxidoreductase (EC 1.1.1.57) |
D-mannonate oxidoreductase (EC 1.1.1.57) |
| uxuA |
Gene: BACCELL_01660: Mannonate dehydratase (EC 4.2.1.8) |
|
Gene: BACDOR_02115: Mannonate dehydratase (EC 4.2.1.8) |
Gene: BACEGG_03380: Mannonate dehydratase (EC 4.2.1.8) |
Gene: BF0142: Mannonate dehydratase (EC 4.2.1.8) |
Gene: BACOVA_00858: Mannonate dehydratase (EC 4.2.1.8) |
Gene: BACPLE_03708: Mannonate dehydratase (EC 4.2.1.8) |
Gene: BACSTE_02442: Mannonate dehydratase (EC 4.2.1.8) |
Gene: BT1432: Mannonate dehydratase (EC 4.2.1.8) |
Gene: BACUNI_01040: Mannonate dehydratase (EC 4.2.1.8) |
Gene: BVU_1262: Mannonate dehydratase (EC 4.2.1.8) |
Mannonate dehydratase (EC 4.2.1.8) |
| CRON 16. | ||||||||||||
| susC_Crp-2 |
|
|
*
Bacteroides dorei DSM 17855 Site: position = -338 score = 5.12548 sequence = AGATATGTTCAACAACATACTA Gene: BACDOR_00155: putative outer membrane protein, probably involved in nutrient binding |
|
|
|
|
|
|
|
*
Bacteroides vulgatus ATCC 8482 Site: position = -340 score = 4.86447 sequence = AGATATGTTCAACAACATAGCA Gene: BVU_0299: putative outer membrane protein, probably involved in nutrient binding |
putative outer membrane protein, probably involved in nutrient binding |
| susD_Crp-2 |
|
|
Gene: BACDOR_00154: Outer membrane polysaccharide binding protein for oligosaccharides |
|
|
|
|
|
|
|
Gene: BVU_0300: Outer membrane polysaccharide binding protein for oligosaccharides |
Outer membrane polysaccharide binding protein for oligosaccharides |
| CRON 17. | ||||||||||||
| sbp_Crp-1 |
|
|
|
|
|
|
|
|
*
Bacteroides thetaiotaomicron VPI-5482 Site: position = -168 score = 5.69902 sequence = TTATATGTTATAGAATATAAAA Gene: BT4080: Six-beta-propeller protein, cell surface exposed, putatively involved in polysaccharides binding |
|
|
Six-beta-propeller protein, cell surface exposed, putatively involved in polysaccharides binding |
| susC_Crp-1 |
|
|
|
|
|
|
|
|
Gene: BT4081: TonB-dependent outer membrane transporter of oligosaccharides |
|
|
TonB-dependent outer membrane transporter of oligosaccharides |
| susD_Crp-1 |
|
|
|
|
|
|
|
|
Gene: BT4082: Outer membrane polysaccharide binding protein for oligosaccharides |
|
|
Outer membrane polysaccharide binding protein for oligosaccharides |
| BT4083 |
|
|
|
|
|
|
|
|
Gene: BT4083: hypothetical protein |
|
|
hypothetical protein |
| BT4084 |
|
|
|
|
|
|
|
|
Gene: BT4084: Glycosyl hydrolase family 43, five-bladed beta-propellor domain |
|
|
Glycosyl hydrolase family 43, five-bladed beta-propellor domain |
| CRON 18. | ||||||||||||
| crp |
*
Bacteroides cellulosilyticus DSM 14838 Site: position = -33 score = 4.67415 sequence = ATTTGTGCTGTATAACACAGTT Gene: BACCELL_03476: transcriptional regulator, Crp/Fnr family |
*
Bacteroides coprophilus DSM 18228 Site: position = -33 score = 4.62586 sequence = TTTTGTGCTTAATAACACGATT Gene: BACCOPRO_01276: transcriptional regulator, Crp/Fnr family |
*
Bacteroides dorei DSM 17855 Site: position = -35 score = 4.14773 sequence = ATTTGTGCTCTATAACACGGTT Gene: BACDOR_01607: transcriptional regulator, Crp/Fnr family |
*
Bacteroides eggerthii DSM 20697 Site: position = -33 score = 4.61709 sequence = ATTTGTGCTGTACAACACAGTT Gene: BACEGG_01340: transcriptional regulator, Crp/Fnr family |
*
Bacteroides fragilis NCTC 9343 Site: position = -33 score = 4.59737 sequence = ATTTGTGCTTTATAACACAGTT Gene: BF0954: transcriptional regulator, Crp/Fnr family |
*
Bacteroides ovatus ATCC 8483 Site: position = -33 score = 4.83116 sequence = TTTTGTGCTGTATAACACAGTT Gene: BACOVA_05152: transcriptional regulator, Crp/Fnr family |
*
Bacteroides plebeius DSM 17135 Site: position = -16 score = 4.08212 sequence = CTTTGTGCTTAATAACATGGTT Gene: BACPLE_02167: transcriptional regulator, Crp/Fnr family |
*
Bacteroides stercoris ATCC 43183 Site: position = -33 score = 4.61709 sequence = ATTTGTGCTGTACAACACAGTT Gene: BACSTE_03515: transcriptional regulator, Crp/Fnr family |
*
Bacteroides thetaiotaomicron VPI-5482 Site: position = -33 score = 4.83116 sequence = TTTTGTGCTGTATAACACAGTT Gene: BT4338: transcriptional regulator, Crp/Fnr family |
*
Bacteroides uniformis ATCC 8492 Site: position = -33 score = 4.67415 sequence = ATTTGTGCTGTATAACACAGTT Gene: BACUNI_04721: transcriptional regulator, Crp/Fnr family |
*
Bacteroides vulgatus ATCC 8482 Site: position = -35 score = 4.14773 sequence = ATTTGTGCTCTATAACACGGTT Gene: BVU_3580: transcriptional regulator, Crp/Fnr family |
transcriptional regulator, Crp/Fnr family |
| hex |
Gene: BACCELL_03475: Beta-hexosaminidase (EC 3.2.1.52) |
|
Gene: BACDOR_03491: Beta-hexosaminidase (EC 3.2.1.52) |
|
Gene: BF0953: Beta-hexosaminidase (EC 3.2.1.52) |
Gene: BACOVA_05141: Beta-hexosaminidase (EC 3.2.1.52) |
|
|
Gene: BT4337: Beta-hexosaminidase (EC 3.2.1.52) |
|
Gene: BVU_2209: Beta-hexosaminidase (EC 3.2.1.52) |
Beta-hexosaminidase (EC 3.2.1.52) |
| CRON 19. | ||||||||||||
| COG3533 |
|
|
|
|
*
Bacteroides fragilis NCTC 9343 Site: position = -143 score = 5.71151 sequence = GTATATGTTTTGTAACATAATA Gene: BF0316: Six-hairpin glycosidase-like, COG3533 family |
|
|
|
*
Bacteroides thetaiotaomicron VPI-5482 Site: position = -111 score = 4.76959 sequence = GTATGTGTTTTACAACATACAG Gene: BT2097: Six-hairpin glycosidase-like, COG3533 family |
|
|
Six-hairpin glycosidase-like, COG3533 family |
| BF0317 |
|
|
|
|
Gene: BF0317: Alpha-N-arabinofuranosidase (EC 3.2.1.55) |
|
|
|
|
|
|
Alpha-N-arabinofuranosidase (EC 3.2.1.55) |
| BF0318 |
|
|
|
|
Gene: BF0318: Alpha-rhamnosidase |
|
|
|
|
|
|
Alpha-rhamnosidase |
| CRON 20. | ||||||||||||
| araM |
*
Bacteroides cellulosilyticus DSM 14838 Site: position = -105 score = 6.01606 sequence = TTTTATGTTACATAACATATAC Gene: BACCELL_05604: Aldose 1-epimerase (EC 5.1.3.3), L-arabinose mutarotase |
|
*
Bacteroides dorei DSM 17855 Site: position = -104 score = 5.58788 sequence = TTTTATGTTGCACAACATACTC Gene: BACDOR_03634: Aldose 1-epimerase (EC 5.1.3.3), L-arabinose mutarotase |
*
Bacteroides eggerthii DSM 20697 Site: position = -105 score = 6.1419 sequence = TTTTATGTTACATAACATACAA Gene: BACEGG_01536: Aldose 1-epimerase (EC 5.1.3.3), L-arabinose mutarotase |
|
*
Bacteroides ovatus ATCC 8483 Site: position = -105 score = 5.86264 sequence = ATTTATGCTGCACAACATATAA Gene: BACOVA_01715: Aldose 1-epimerase (EC 5.1.3.3), L-arabinose mutarotase |
*
Bacteroides plebeius DSM 17135 Site: position = -89 score = 4.91226 sequence = TTCTATGTTGAAAAACATCTGA Gene: BACPLE_02214: Aldose 1-epimerase (EC 5.1.3.3), L-arabinose mutarotase |
|
*
Bacteroides thetaiotaomicron VPI-5482 Site: position = -105 score = 6.17112 sequence = TTTTATGTTGCACAACATATAA Gene: BT0356: Aldose 1-epimerase (EC 5.1.3.3), L-arabinose mutarotase |
*
Bacteroides uniformis ATCC 8492 Site: position = -48 score = 5.70651 sequence = ACTTATGTTGCATAACATATAA Gene: BACUNI_01357: Aldose 1-epimerase (EC 5.1.3.3), L-arabinose mutarotase |
*
Bacteroides vulgatus ATCC 8482 Site: position = -104 score = 5.58788 sequence = TTTTATGTTGCACAACATACTC Gene: BVU_2324: Aldose 1-epimerase (EC 5.1.3.3), L-arabinose mutarotase |
Aldose 1-epimerase (EC 5.1.3.3), L-arabinose mutarotase |
| araP |
Gene: BACCELL_05605: Predicted sodium-dependent arabinose transporter |
|
Gene: BACDOR_03633: Predicted sodium-dependent arabinose transporter |
Gene: BACEGG_01535: Predicted sodium-dependent arabinose transporter |
|
Gene: BACOVA_01714: Predicted sodium-dependent arabinose transporter |
Gene: BACPLE_02216: Predicted sodium-dependent arabinose transporter |
|
Gene: BT0355: Predicted sodium-dependent arabinose transporter |
Gene: BACUNI_01358: Predicted sodium-dependent arabinose transporter |
Gene: BVU_2323: Predicted sodium-dependent arabinose transporter |
Predicted sodium-dependent arabinose transporter |
| araR |
Gene: BACCELL_05606: Predicted transcriptional regulator for arabinose utilization, NrtR family |
|
Gene: BACDOR_03632: Predicted transcriptional regulator for arabinose utilization, NrtR family |
Gene: BACEGG_01534: Predicted transcriptional regulator for arabinose utilization, NrtR family |
|
Gene: BACOVA_01713: Predicted transcriptional regulator for arabinose utilization, NrtR family |
Gene: BACPLE_02213: Predicted transcriptional regulator for arabinose utilization, NrtR family |
|
Gene: BT0354: Predicted transcriptional regulator for arabinose utilization, NrtR family |
Gene: BACUNI_01359: Predicted transcriptional regulator for arabinose utilization, NrtR family |
Gene: BVU_2322: Predicted transcriptional regulator for arabinose utilization, NrtR family |
Predicted transcriptional regulator for arabinose utilization, NrtR family |
| araD |
Gene: BACCELL_05607: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4) |
|
Gene: BACDOR_03631: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4) |
Gene: BACEGG_01533: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4) |
|
Gene: BACOVA_01712: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4) |
Gene: BACPLE_02212: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4) |
|
Gene: BT0353: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4) |
Gene: BACUNI_01360: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4) |
Gene: BVU_2321: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4) |
L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4) |
| BT0352 |
|
|
|
|
|
|
|
|
Gene: BT0352: hypothetical protein |
|
|
hypothetical protein |
| araA |
Gene: BACCELL_05608: L-arabinose isomerase (EC 5.3.1.4) |
|
Gene: BACDOR_03630: L-arabinose isomerase (EC 5.3.1.4) |
Gene: BACEGG_01532: L-arabinose isomerase (EC 5.3.1.4) |
|
Gene: BACOVA_01711: L-arabinose isomerase (EC 5.3.1.4) |
Gene: BACPLE_02211: L-arabinose isomerase (EC 5.3.1.4) |
|
Gene: BT0351: L-arabinose isomerase (EC 5.3.1.4) |
Gene: BACUNI_01361: L-arabinose isomerase (EC 5.3.1.4) |
Gene: BVU_2320: L-arabinose isomerase (EC 5.3.1.4) |
L-arabinose isomerase (EC 5.3.1.4) |
| araB |
Gene: BACCELL_05609: Ribulokinase (EC 2.7.1.16) |
|
Gene: BACDOR_03629: Ribulokinase (EC 2.7.1.16) |
Gene: BACEGG_01531: Ribulokinase (EC 2.7.1.16) |
|
Gene: BACOVA_01710: Ribulokinase (EC 2.7.1.16) |
Gene: BACPLE_02210: Ribulokinase (EC 2.7.1.16) |
|
Gene: BT0350: Ribulokinase (EC 2.7.1.16) |
Gene: BACUNI_01362: Ribulokinase (EC 2.7.1.16) |
Gene: BVU_2319: Ribulokinase (EC 2.7.1.16) |
Ribulokinase (EC 2.7.1.16) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |