Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing susD_Rgu-1 gene

Properties
Regulog: Crp - Bacteroidaceae
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: activator
Biological process:
Effector:
Phylum: Bacteroidetes
Built upon 113 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bacteroides cellulosilyticus DSM 14838
Position: -184
Score: 5.75749
Sequence: TTTTCTGTTATATAACATCATT
Locus tag: BACCELL_03135
Name: susC_Rgu-1
Funciton: TonB-dependent outer membrane transporter of rhamnogalacturonan oligomers
Locus tag: BACCELL_03134
Name: susD_Rgu-1
Funciton: Outer membrane polysaccharide binding protein for rhamnogalacturonan oligomers
Locus tag: BACCELL_03133
Name: BT4112
Funciton: Predicted pectin lyase
susC_Rgu-1-susD_Rgu-1-BT4112 -184 5.8 TTTTCTGTTATATAACATCATT BACCELL_03135
Bacteroides eggerthii DSM 20697
Position: -185
Score: 5.28078
Sequence: ATTTCTGCTTTACAACATACTC
Locus tag: BACEGG_00870
Name: susC_Rgu-1
Funciton: TonB-dependent outer membrane transporter of rhamnogalacturonan oligomers
Locus tag: BACEGG_00869
Name: susD_Rgu-1
Funciton: Outer membrane polysaccharide binding protein for rhamnogalacturonan oligomers
Locus tag: BACEGG_00868
Name: BT4112
Funciton: Predicted pectin lyase
susC_Rgu-1-susD_Rgu-1-BT4112 -185 5.3 ATTTCTGCTTTACAACATACTC BACEGG_00870