Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing sbp_Crp-1 gene

Properties
Regulog: Crp - Bacteroidaceae
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: activator
Biological process:
Effector:
Phylum: Bacteroidetes
Built upon 113 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bacteroides thetaiotaomicron VPI-5482
Position: -168
Score: 5.69902
Sequence: TTATATGTTATAGAATATAAAA
Locus tag: BT4080
Name: sbp_Crp-1
Funciton: Six-beta-propeller protein, cell surface exposed, putatively involved in polysaccharides binding
Locus tag: BT4081
Name: susC_Crp-1
Funciton: TonB-dependent outer membrane transporter of oligosaccharides
Locus tag: BT4082
Name: susD_Crp-1
Funciton: Outer membrane polysaccharide binding protein for oligosaccharides
Locus tag: BT4083
Name: null
Funciton: hypothetical protein
Locus tag: BT4084
Name: BT4084
Funciton: Glycosyl hydrolase family 43, five-bladed beta-propellor domain
sbp_Crp-1-susC_Crp-1-susD_Crp-1-BT4083-BT4084 -168 5.7 TTATATGTTATAGAATATAAAA BT4080