Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing susD_Crp-3 gene

Properties
Regulog: Crp - Bacteroidaceae
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: activator
Biological process:
Effector:
Phylum: Bacteroidetes
Built upon 113 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bacteroides cellulosilyticus DSM 14838
Position: -225
Score: 5.37678
Sequence: TTCTATGTTCTATAACATGCAA
Locus tag: BACCELL_03480
Name: susC_Crp-3
Funciton: TonB-dependent outer membrane transporter of oligosaccharides
Locus tag: BACCELL_03481
Name: susD_Crp-3
Funciton: Outer membrane polysaccharide binding protein for oligosaccharides
Locus tag: BACCELL_03482
Name: BACCELL_03482
Funciton: Galactose-binding domain-like
Locus tag: BACCELL_03483
Name: PF00722
Funciton: Glycoside hydrolase, family 16
Locus tag: BACCELL_03484
Name: PF00933
Funciton: Glycoside hydrolase, family 3
susC_Crp-3-susD_Crp-3-BACCELL_03482-PF00722-PF00933 -225 5.4 TTCTATGTTCTATAACATGCAA BACCELL_03480
Bacteroides uniformis ATCC 8492
Position: -225
Score: 4.9997
Sequence: TTTTGTGTTATATAACATGTTG
Locus tag: BACUNI_01489
Name: susC_Crp-3
Funciton: TonB-dependent outer membrane transporter of oligosaccharides
Locus tag: BACUNI_01488
Name: susD_Crp-3
Funciton: Outer membrane polysaccharide binding protein for oligosaccharides
Locus tag: BACUNI_01487
Name: BACCELL_03482
Funciton: Galactose-binding domain-like
susC_Crp-3-susD_Crp-3-BACCELL_03482 -225 5 TTTTGTGTTATATAACATGTTG BACUNI_01489