Regulog HrcA - Streptococcaceae

Properties
Regulator type:	Transcription factor
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Phylum:	Firmicutes
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 49 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By trascription factor - HrcA
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Statistics of regulated genes
Genome	Genes	Operons
Lactococcus lactis subsp. cremoris SK11	6	3
Lactococcus lactis subsp. lactis Il1403	6	3
Streptococcus agalactiae 2603V/R	6	3
Streptococcus dysgalactiae subsp. equisimilis GGS_124	6	3
Streptococcus equi subsp. zooepidemicus MGCS10565	5	3
Streptococcus gallolyticus UCN34	7	3
Streptococcus gordonii str. Challis substr. CH1	4	2
Streptococcus mitis B6	4	2
Streptococcus mutans UA159	4	2
Streptococcus pneumoniae TIGR4	4	2
Streptococcus pyogenes M1 GAS	5	2
Streptococcus sanguinis SK36	4	2
Streptococcus suis 05ZYH33	6	2
Streptococcus thermophilus CNRZ1066	5	2
Streptococcus uberis 0140J	6	3

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes																Function

CRON 1.
clpL	Lactococcus lactis subsp. cremoris SK11 Gene: LACR_0578: ATP-dependent Clp protease, ATP-binding subunit	Lactococcus lactis subsp. lactis Il1403 Gene: L0221: ATP-dependent Clp protease, ATP-binding subunit	* Streptococcus agalactiae 2603V/R Site: position = -143 score = 6.94221 sequence = TTAGCACTCTAATATATTCAGTGCTAA Gene: SAG0488: ATP-dependent Clp protease, ATP-binding subunit	* Streptococcus dysgalactiae subsp. equisimilis GGS_124 Site: position = -141 score = 6.09771 sequence = TTATCACTCTATCCCTGACAGTGCTAA Gene: SDEG_1496: ATP-dependent Clp protease, ATP-binding subunit	* Streptococcus equi subsp. zooepidemicus MGCS10565 Site: position = -141 score = 5.93765 sequence = TTATCACTCTATACTGGATAGTGCTAA Gene: Sez_0605: ATP-dependent Clp protease, ATP-binding subunit	* Streptococcus gallolyticus UCN34 Site: position = -144 score = 7.13899 sequence = ATAGCACTCTTAGCATAAGAGTGCTAA Gene: GALLO_0612: ATP-dependent Clp protease, ATP-binding subunit	Streptococcus gordonii str. Challis substr. CH1 Gene: SGO_0688: ATP-dependent Clp protease, ATP-binding subunit	Streptococcus mitis B6 Gene: smi_0865: ATP-dependent Clp protease, ATP-binding subunit	Streptococcus mutans UA159 Gene: SMU.562: ATP-dependent Clp protease, ATP-binding subunit	Streptococcus pneumoniae TIGR4 Gene: SP_0820: ATP-dependent Clp protease, ATP-binding subunit	Streptococcus pyogenes M1 GAS Gene: SPy1509: ATP-dependent Clp protease, ATP-binding subunit	Streptococcus sanguinis SK36 Gene: SSA_0669: ATP-dependent Clp protease, ATP-binding subunit	Streptococcus suis 05ZYH33 Gene: SSU05_0492: ATP-dependent Clp protease, ATP-binding subunit	Streptococcus thermophilus CNRZ1066 Gene: str0602: ATP-dependent Clp protease, ATP-binding subunit	* Streptococcus uberis 0140J Site: position = -140 score = 5.96507 sequence = TTATCACTCTAAGTCACTAAGTGCTAA Gene: SUB1281: ATP-dependent Clp protease, ATP-binding subunit	ATP-dependent Clp protease, ATP-binding subunit

CRON 2.
groS	* Lactococcus lactis subsp. cremoris SK11 Site: position = -51 score = 7.12674 sequence = TTAGCACACAACTATTAAGAGTGCTAA Gene: LACR_0439: Heat shock protein 60 family co-chaperone GroES	* Lactococcus lactis subsp. lactis Il1403 Site: position = -52 score = 7.89697 sequence = TTAGCACTCGTTTAATAAGAGTGCTAA Gene: L198515: Heat shock protein 60 family co-chaperone GroES	* Streptococcus agalactiae 2603V/R Site: position = -64 score = 7.5469 sequence = TTAGCACTCTCTGTATAAGAGTGCTAA Gene: SAG2075: Heat shock protein 60 family co-chaperone GroES	* Streptococcus dysgalactiae subsp. equisimilis GGS_124 Site: position = -61 score = 7.66213 sequence = TTAGCACTCGTACAACAAGAGTGCTAA Gene: SDEG_2041: Heat shock protein 60 family co-chaperone GroES	* Streptococcus equi subsp. zooepidemicus MGCS10565 Site: position = -65 score = 7.72636 sequence = TTAGCACTCATAAAACAAGAGTGCTAA Gene: Sez_0145: Heat shock protein 60 family co-chaperone GroES	* Streptococcus gallolyticus UCN34 Site: position = -86 score = 7.53403 sequence = TTAGCACTCGATGTATTAGAGTGCTAA Gene: GALLO_0124: Heat shock protein 60 family co-chaperone GroES	* Streptococcus gordonii str. Challis substr. CH1 Site: position = -50 score = 7.33471 sequence = TTAGCACTCGATAGACGAGAGTGCTAA Gene: SGO_1886: Heat shock protein 60 family co-chaperone GroES	* Streptococcus mitis B6 Site: position = -57 score = 7.72407 sequence = TTAGCACTCATCTATAAAGAGTGCTAA Gene: smi_0481: Heat shock protein 60 family co-chaperone GroES	* Streptococcus mutans UA159 Site: position = -46 score = 6.96514 sequence = TTAGCACTCAGTATATTGGAGTGCTAA Gene: SMU.1955: Heat shock protein 60 family co-chaperone GroES	* Streptococcus pneumoniae TIGR4 Site: position = -57 score = 7.57272 sequence = TTAGCACTCAAGTTCAAAGAGTGCTAA Gene: SP_1907: Heat shock protein 60 family co-chaperone GroES	* Streptococcus pyogenes M1 GAS Site: position = -62 score = 7.10575 sequence = TTAGCCCTCGATGAACATGAGTGCTAA Gene: SPy2072: Heat shock protein 60 family co-chaperone GroES	* Streptococcus sanguinis SK36 Site: position = -51 score = 7.32891 sequence = TTAGCACTCGATAGTTTAGAGTGCTAA Gene: SSA_0225: Heat shock protein 60 family co-chaperone GroES	* Streptococcus suis 05ZYH33 Site: position = -20 score = 7.71588 sequence = TTAGCACTCGAATACAAAGAGTGCTAA Gene: SSU05_0147: Heat shock protein 60 family co-chaperone GroES	* Streptococcus thermophilus CNRZ1066 Site: position = -79 score = 6.43514 sequence = TTAGCAGTTGTCTATCGTGAGTGCTAA Gene: str0203: Heat shock protein 60 family co-chaperone GroES	* Streptococcus uberis 0140J Site: position = -63 score = 7.46042 sequence = TTGGCACTCTTTTTTAAAGAGTGCTAA Gene: SUB1742: Heat shock protein 60 family co-chaperone GroES	Heat shock protein 60 family co-chaperone GroES
groL	Lactococcus lactis subsp. cremoris SK11 Gene: LACR_0440: Heat shock protein 60 family chaperone GroEL	Lactococcus lactis subsp. lactis Il1403 Gene: L198893: Heat shock protein 60 family chaperone GroEL	Streptococcus agalactiae 2603V/R Gene: SAG2074: Heat shock protein 60 family chaperone GroEL	Streptococcus dysgalactiae subsp. equisimilis GGS_124 Gene: SDEG_2040: Heat shock protein 60 family chaperone GroEL	Streptococcus equi subsp. zooepidemicus MGCS10565 Gene: Sez_0146: Heat shock protein 60 family chaperone GroEL	Streptococcus gallolyticus UCN34 Gene: GALLO_0125: Heat shock protein 60 family chaperone GroEL	Streptococcus gordonii str. Challis substr. CH1 Gene: SGO_1885: Heat shock protein 60 family chaperone GroEL	Streptococcus mitis B6 Gene: smi_0482: Heat shock protein 60 family chaperone GroEL	Streptococcus mutans UA159 Gene: SMU.1954: Heat shock protein 60 family chaperone GroEL	Streptococcus pneumoniae TIGR4 Gene: SP_1906: Heat shock protein 60 family chaperone GroEL	Streptococcus pyogenes M1 GAS Gene: SPy2070: Heat shock protein 60 family chaperone GroEL	Streptococcus sanguinis SK36 Gene: SSA_0226: Heat shock protein 60 family chaperone GroEL	2 Streptococcus suis 05ZYH33 Gene: SSU05_0148: Heat shock protein 60 family chaperone GroEL Gene: SSU05_0149: Heat shock protein 60 family chaperone GroEL	Streptococcus thermophilus CNRZ1066 Gene: str0204: Heat shock protein 60 family chaperone GroEL	Streptococcus uberis 0140J Gene: SUB1741: Heat shock protein 60 family chaperone GroEL	Heat shock protein 60 family chaperone GroEL

CRON 3.
hrcA	* Lactococcus lactis subsp. cremoris SK11 Site: position = -61 score = 6.98125 sequence = TTAGCACTTAGAGGTAAAGAGTGCTAA Site: position = -141 score = 8.07475 sequence = TTAGCACTCTAATAAAAAGAGTGCTAA Gene: LACR_1025: Heat shock response transcriptional regulator HrcA, HrcA family	* Lactococcus lactis subsp. lactis Il1403 Site: position = -134 score = 6.73416 sequence = TTAGCACTTAGAGATGAAGAGTGCTAA Site: position = -214 score = 7.84319 sequence = TTAGCACTCTACCAAAAAGAGTGCTAA Gene: L0212: Heat shock response transcriptional regulator HrcA, HrcA family	* Streptococcus agalactiae 2603V/R Site: position = -58 score = 7.18738 sequence = TTAGCAGTCGATGTGTAAGAGTGCTAA Site: position = -140 score = 7.92485 sequence = TTAGCACTCTTTGAATAAGAGTGCTAA Gene: SAG0095: Heat shock response transcriptional regulator HrcA, HrcA family	* Streptococcus dysgalactiae subsp. equisimilis GGS_124 Site: position = -47 score = 7.12648 sequence = TTAGCAGTCAGATACATAGAGTGCTAA Gene: SDEG_1830: Heat shock response transcriptional regulator HrcA, HrcA family	* Streptococcus equi subsp. zooepidemicus MGCS10565 Site: position = -48 score = 6.87441 sequence = TTAGCAGTCCGATGTATAGAGTGCTAA Gene: Sez_0400: Heat shock response transcriptional regulator HrcA, HrcA family	* Streptococcus gallolyticus UCN34 Site: position = -47 score = 7.14967 sequence = TTAGCAGTCGAGGTATATGAGTGCTAA Site: position = -130 score = 7.98648 sequence = TTAGCACTCTACTAAAAAGAGTGCTAA Gene: GALLO_0241: Heat shock response transcriptional regulator HrcA, HrcA family	* Streptococcus gordonii str. Challis substr. CH1 Site: position = -59 score = 6.34345 sequence = TTAGCACTCAAAGTGGTCGAGTGCTAA Site: position = -142 score = 7.89283 sequence = TTAGCACTCTTGCAAAAAGAGTGCTAA Gene: SGO_0400: Heat shock response transcriptional regulator HrcA, HrcA family	* Streptococcus mitis B6 Site: position = -53 score = 6.45482 sequence = TTAGCACTTGAGTGCATCGAGTGCTAA Site: position = -136 score = 7.5173 sequence = TTAGCACTCTTGATGAAAGAGTGCTAA Gene: smi_0353: Heat shock response transcriptional regulator HrcA, HrcA family	* Streptococcus mutans UA159 Site: position = -59 score = 7.24026 sequence = TTAGCAGTCGTCTGTTAAGAGTGCTAA Site: position = -143 score = 7.47985 sequence = TTAGCACTCAAGCAGAAAGAGTGCTAA Gene: SMU.80: Heat shock response transcriptional regulator HrcA, HrcA family	* Streptococcus pneumoniae TIGR4 Site: position = -53 score = 6.47442 sequence = TTAGCACTTGGATGCATTGAGTGCTAA Site: position = -136 score = 7.83794 sequence = TTAGCACTCTTGATAAAAGAGTGCTAA Gene: SP_0515: Heat shock response transcriptional regulator HrcA, HrcA family	* Streptococcus pyogenes M1 GAS Site: position = -48 score = 7.60178 sequence = TTAGCAGTCTACTAAATAGAGTGCTAA Site: position = -132 score = 7.39069 sequence = TTAGCGCTCTTTATAAAAGAGTGCTAA Gene: SPy1763: Heat shock response transcriptional regulator HrcA, HrcA family	* Streptococcus sanguinis SK36 Site: position = -142 score = 8.03612 sequence = TTAGCACTCTTGTAAAAAGAGTGCTAA Site: position = -59 score = 6.95013 sequence = TTAGCACTCGAGGTGATTGAGTGCTAA Gene: SSA_2009: Heat shock response transcriptional regulator HrcA, HrcA family	* Streptococcus suis 05ZYH33 Site: position = -140 score = 7.37719 sequence = TTAGCACTCGATATCATAGAGTGCTAA Site: position = -226 score = 7.76551 sequence = TTAGCACTCTAAGCAAAAGAGTGCTAA Gene: SSU05_0298: Heat shock response transcriptional regulator HrcA, HrcA family	* Streptococcus thermophilus CNRZ1066 Site: position = -49 score = 7.179 sequence = TTAGCAGTCGTTGTACGAGAGTGCTAA Site: position = -137 score = 7.95571 sequence = TTAGCACTCTTTCAAAAAGAGTGCTAA Gene: str0118: Heat shock response transcriptional regulator HrcA, HrcA family	* Streptococcus uberis 0140J Site: position = -45 score = 7.12004 sequence = TTAGCAGTCTTAGCATCAGAGTGCTAA Gene: SUB1506: Heat shock response transcriptional regulator HrcA, HrcA family	Heat shock response transcriptional regulator HrcA, HrcA family
grpE	Lactococcus lactis subsp. cremoris SK11 Gene: LACR_1026: Heat shock protein GrpE	Lactococcus lactis subsp. lactis Il1403 Gene: L0273: Heat shock protein GrpE	Streptococcus agalactiae 2603V/R Gene: SAG0096: Heat shock protein GrpE	Streptococcus dysgalactiae subsp. equisimilis GGS_124 Gene: SDEG_1829: Heat shock protein GrpE	Streptococcus equi subsp. zooepidemicus MGCS10565 Gene: Sez_0401: Heat shock protein GrpE	Streptococcus gallolyticus UCN34 Gene: GALLO_0242: Heat shock protein GrpE	Streptococcus gordonii str. Challis substr. CH1 Gene: SGO_0401: Heat shock protein GrpE	Streptococcus mitis B6 Gene: smi_0354: Heat shock protein GrpE	Streptococcus mutans UA159 Gene: SMU.81: Heat shock protein GrpE	Streptococcus pneumoniae TIGR4 Gene: SP_0516: Heat shock protein GrpE	Streptococcus pyogenes M1 GAS Gene: SPy1761: Heat shock protein GrpE	Streptococcus sanguinis SK36 Gene: SSA_2008: Heat shock protein GrpE	Streptococcus suis 05ZYH33 Gene: SSU05_0299: Heat shock protein GrpE	Streptococcus thermophilus CNRZ1066 Gene: str0119: Heat shock protein GrpE	Streptococcus uberis 0140J Gene: SUB1505: Heat shock protein GrpE	Heat shock protein GrpE
dnaK	Lactococcus lactis subsp. cremoris SK11 Gene: LACR_1027: Chaperone protein DnaK	Lactococcus lactis subsp. lactis Il1403 Gene: L178206: Chaperone protein DnaK	Streptococcus agalactiae 2603V/R Gene: SAG0097: Chaperone protein DnaK	Streptococcus dysgalactiae subsp. equisimilis GGS_124 Gene: SDEG_1827: Chaperone protein DnaK	Streptococcus equi subsp. zooepidemicus MGCS10565 Gene: Sez_0402: Chaperone protein DnaK	Streptococcus gallolyticus UCN34 Gene: GALLO_0243: Chaperone protein DnaK	Streptococcus gordonii str. Challis substr. CH1 Gene: SGO_0402: Chaperone protein DnaK	Streptococcus mitis B6 Gene: smi_0355: Chaperone protein DnaK	Streptococcus mutans UA159 Gene: SMU.82: Chaperone protein DnaK	Streptococcus pneumoniae TIGR4 Gene: SP_0517: Chaperone protein DnaK	Streptococcus pyogenes M1 GAS Gene: SPy1760: Chaperone protein DnaK	Streptococcus sanguinis SK36 Gene: SSA_2007: Chaperone protein DnaK	Streptococcus suis 05ZYH33 Gene: SSU05_0300: Chaperone protein DnaK	Streptococcus thermophilus CNRZ1066 Gene: str0120: Chaperone protein DnaK	Streptococcus uberis 0140J Gene: SUB1504: Chaperone protein DnaK	Chaperone protein DnaK
dnaJ	* Lactococcus lactis subsp. cremoris SK11 Site: position = -108 score = 7.87005 sequence = TTAGCACTCTGATAAAAAGAGTGCTAA Gene: LACR_2529: Chaperone protein DnaJ	* Lactococcus lactis subsp. lactis Il1403 Site: position = -108 score = 8.06015 sequence = TTAGCACTCTTATAAAAAGAGTGCTAA Gene: L0272: Chaperone protein DnaJ	Streptococcus agalactiae 2603V/R Gene: SAG0098: Chaperone protein DnaJ	Streptococcus dysgalactiae subsp. equisimilis GGS_124 Gene: SDEG_1825: Chaperone protein DnaJ	Streptococcus equi subsp. zooepidemicus MGCS10565 Gene: Sez_0403: Chaperone protein DnaJ	Streptococcus gallolyticus UCN34 Gene: GALLO_0245: Chaperone protein DnaJ	Streptococcus gordonii str. Challis substr. CH1 Gene: SGO_0404: Chaperone protein DnaJ	Streptococcus mitis B6	Streptococcus mutans UA159 Gene: SMU.83: Chaperone protein DnaJ	Streptococcus pneumoniae TIGR4 Gene: SP_0519: Chaperone protein DnaJ	Streptococcus pyogenes M1 GAS Gene: SPy1759: Chaperone protein DnaJ	Streptococcus sanguinis SK36 Gene: SSA_2005: Chaperone protein DnaJ	Streptococcus suis 05ZYH33 Gene: SSU05_0302: Chaperone protein DnaJ	Streptococcus thermophilus CNRZ1066 Gene: str0121: Chaperone protein DnaJ	Streptococcus uberis 0140J Gene: SUB1503: Chaperone protein DnaJ	Chaperone protein DnaJ

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog HrcA - Streptococcaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --